Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZDHHC9 cdna clone

ZDHHC9 cDNA Clone

Gene Names
ZDHHC9; CGI89; DHHC9; MMSA1; MRXSZ; ZNF379; ZNF380; CXorf11; ZDHHC10
Synonyms
ZDHHC9; ZDHHC9 cDNA Clone; ZDHHC9 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgtgatggtggtgagaaagaaggtgacacggaaatgggagaaactcccaggcaggaacaccttttgctgtgatggccgcgtcatgatggcccggcaaaagggcattttctacctgacccttttcctcatcctggggacatgtacactcttcttcgcctttgagtgccgctacctggctgttcagctgtctcctgccatccctgtatttgctgccatgctcttccttttctccatggctacactgttgaggaccagcttcagtgaccctggagtgattcctcgggcgctaccagatgaagcagctttcatagaaatggagatagaagctaccaatggtgcggtgccccagggccagcgaccaccgcctcgtatcaagaatttccagataaacaaccagattgtgaaactgaaatactgttacacatgcaagatcttccggcctccccgggcctcccattgcagcatctgtgacaactgtgtggagcgcttcgaccatcactgcccctgggtggggaattgtgttggaaagaggaactaccgctacttctacctcttcatcctttctctctccctcctcacaatctatgtcttcgccttcaacatcgtctatgtggccctcaaatctttgaaaattggcttcttggagacattgaaagaaactcctggaactgttctagaagtcctcatttgcttctttacactctggtccgtcgtgggactgactggatttcatactttcctcgtggctctcaaccagacaaccaatgaagacatcaaaggatcatggacagggaagaatcgcgtccagaatccctacagccatggcaatattgtgaagaactgctgtgaagtgctgtgtggccccttgccccccagtgtgctggatcgaaggggtattttgccactggaggaaagtggaagtcgacctcccagtactcaagagaccagtagcagcctcttgccacagagcccagcccccacagaacacctgaactcaaatgagatgccggaggacagcagcactcccgaagagatgccacctccagagcccccagagccaccacaggaggcagctgaagctgagaagtag
Sequence Length
1095
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,916 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 9, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 9
NCBI Official Symbol
ZDHHC9
NCBI Official Synonym Symbols
CGI89; DHHC9; MMSA1; MRXSZ; ZNF379; ZNF380; CXorf11; ZDHHC10
NCBI Protein Information
palmitoyltransferase ZDHHC9
UniProt Protein Name
Palmitoyltransferase ZDHHC9
Protein Family
UniProt Gene Name
ZDHHC9
UniProt Synonym Gene Names
CXorf11; ZDHHC10; ZNF379; ZNF380; DHHC-9; DHHC9
UniProt Entry Name
ZDHC9_HUMAN

NCBI Description

This gene encodes an integral membrane protein that is a member of the zinc finger DHHC domain-containing protein family. The encoded protein forms a complex with golgin subfamily A member 7 and functions as a palmitoyltransferase. This protein specifically palmitoylates HRAS and NRAS. Mutations in this gene are associated with X-linked mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, May 2010]

Uniprot Description

ZDHHC9: The ZDHHC9-GOLGA7 complex is a palmitoyltransferase specific for HRAS and NRAS. Defects in ZDHHC9 are the cause of mental retardation syndromic X-linked ZDHHC9-related (MRXSZ). A disorder characterized by significantly sub-average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. Some patients have marfanoid habitus as an additional feature. Belongs to the DHHC palmitoyltransferase family. ERF2/ZDHHC9 subfamily.

Protein type: EC 2.3.1.225; Transferase; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: Xq26.1

Cellular Component: cytoplasm; endoplasmic reticulum; Golgi apparatus; intrinsic to Golgi membrane

Molecular Function: palmitoyltransferase activity; Ras palmitoyltransferase activity

Biological Process: peptidyl-S-palmitoyl-L-cysteine biosynthetic process from peptidyl-cysteine; protein palmitoylation

Disease: Mental Retardation, X-linked, Syndromic, Raymond Type

Research Articles on ZDHHC9

Similar Products

Product Notes

The ZDHHC9 zdhhc9 (Catalog #AAA1267948) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgtga tggtggtgag aaagaaggtg acacggaaat gggagaaact cccaggcagg aacacctttt gctgtgatgg ccgcgtcatg atggcccggc aaaagggcat tttctacctg acccttttcc tcatcctggg gacatgtaca ctcttcttcg cctttgagtg ccgctacctg gctgttcagc tgtctcctgc catccctgta tttgctgcca tgctcttcct tttctccatg gctacactgt tgaggaccag cttcagtgac cctggagtga ttcctcgggc gctaccagat gaagcagctt tcatagaaat ggagatagaa gctaccaatg gtgcggtgcc ccagggccag cgaccaccgc ctcgtatcaa gaatttccag ataaacaacc agattgtgaa actgaaatac tgttacacat gcaagatctt ccggcctccc cgggcctccc attgcagcat ctgtgacaac tgtgtggagc gcttcgacca tcactgcccc tgggtgggga attgtgttgg aaagaggaac taccgctact tctacctctt catcctttct ctctccctcc tcacaatcta tgtcttcgcc ttcaacatcg tctatgtggc cctcaaatct ttgaaaattg gcttcttgga gacattgaaa gaaactcctg gaactgttct agaagtcctc atttgcttct ttacactctg gtccgtcgtg ggactgactg gatttcatac tttcctcgtg gctctcaacc agacaaccaa tgaagacatc aaaggatcat ggacagggaa gaatcgcgtc cagaatccct acagccatgg caatattgtg aagaactgct gtgaagtgct gtgtggcccc ttgcccccca gtgtgctgga tcgaaggggt attttgccac tggaggaaag tggaagtcga cctcccagta ctcaagagac cagtagcagc ctcttgccac agagcccagc ccccacagaa cacctgaact caaatgagat gccggaggac agcagcactc ccgaagagat gccacctcca gagcccccag agccaccaca ggaggcagct gaagctgaga agtag. It is sometimes possible for the material contained within the vial of "ZDHHC9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.