Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZDHHC21 cdna clone

ZDHHC21 cDNA Clone

Gene Names
ZDHHC21; DNZ1; DHHC21; DHHC-21; HSPC097; 9130404H11Rik
Synonyms
ZDHHC21; ZDHHC21 cDNA Clone; ZDHHC21 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtctccggattcactttgttgttgacccacatggttggtgctgcatgggtttgattgtctttgtttggttatacaatattgttttaattcccaaaattgtcctctttcctcactatgaagaaggacatattccaggcatattaataataatattctatggcatttccatattctgtctggttgccttagtgagggcctccataactgatccaggaagactccctgagaaccccaagatcccacatggagaaagggagttctgggaattatgtaacaagtgtaatttgatgagaccaaagcgttcccatcactgcagccgctgcggccactgtgtgaggagaatggatcatcactgtccatggattaacaattgtgttggtgaagataatcattggctctttctgcagttgtgtttctacactgaacttcttacttgctacgcactgatgttttctttctgccactattactattttcttccactaaaaaagcgtaatttggacctctttgtttttagacatgaattggccataatgagactagcagcctttatgggcattactatgttagttggaataactggactcttttacactcaactaattggcatcatcacagatacaacatctattgaaaagatgtcaaactgttgtgaagatatatcgaggccccgaaagccatggcagcagaccttctcagaagtttttggcactcgttggaagatcctgtggttcattcctttcaggcagaggcaaccactgcgagttccctaccactttgccaatcatgtctaa
Sequence Length
798
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,385 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 21, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 21
NCBI Official Symbol
ZDHHC21
NCBI Official Synonym Symbols
DNZ1; DHHC21; DHHC-21; HSPC097; 9130404H11Rik
NCBI Protein Information
palmitoyltransferase ZDHHC21
UniProt Protein Name
Palmitoyltransferase ZDHHC21
Protein Family
UniProt Gene Name
ZDHHC21
UniProt Synonym Gene Names
DHHC-21
UniProt Entry Name
ZDH21_HUMAN

Uniprot Description

ZDHHC21: Palmitoylates sex steroid hormone receptors, including ESR1, PGR and AR, thereby regulating their targeting to the plasma membrane. This affects rapid intracellular signaling by sex hormones via ERK and AKT kinases and the generation of cAMP, but does not affect that mediated by their nuclear receptor. Belongs to the DHHC palmitoyltransferase family.

Protein type: Transferase; EC 2.3.1.225; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 9p22.3

Cellular Component: Golgi apparatus; Golgi membrane; plasma membrane

Molecular Function: palmitoyltransferase activity

Biological Process: peptidyl-S-palmitoyl-L-cysteine biosynthetic process from peptidyl-cysteine; protein palmitoylation; regulation of nitric-oxide synthase activity

Research Articles on ZDHHC21

Similar Products

Product Notes

The ZDHHC21 zdhhc21 (Catalog #AAA1274295) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtctcc ggattcactt tgttgttgac ccacatggtt ggtgctgcat gggtttgatt gtctttgttt ggttatacaa tattgtttta attcccaaaa ttgtcctctt tcctcactat gaagaaggac atattccagg catattaata ataatattct atggcatttc catattctgt ctggttgcct tagtgagggc ctccataact gatccaggaa gactccctga gaaccccaag atcccacatg gagaaaggga gttctgggaa ttatgtaaca agtgtaattt gatgagacca aagcgttccc atcactgcag ccgctgcggc cactgtgtga ggagaatgga tcatcactgt ccatggatta acaattgtgt tggtgaagat aatcattggc tctttctgca gttgtgtttc tacactgaac ttcttacttg ctacgcactg atgttttctt tctgccacta ttactatttt cttccactaa aaaagcgtaa tttggacctc tttgttttta gacatgaatt ggccataatg agactagcag cctttatggg cattactatg ttagttggaa taactggact cttttacact caactaattg gcatcatcac agatacaaca tctattgaaa agatgtcaaa ctgttgtgaa gatatatcga ggccccgaaa gccatggcag cagaccttct cagaagtttt tggcactcgt tggaagatcc tgtggttcat tcctttcagg cagaggcaac cactgcgagt tccctaccac tttgccaatc atgtctaa. It is sometimes possible for the material contained within the vial of "ZDHHC21, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.