Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZDHHC2 cdna clone

ZDHHC2 cDNA Clone

Gene Names
ZDHHC2; DHHC2; ZNF372
Synonyms
ZDHHC2; ZDHHC2 cDNA Clone; ZDHHC2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgccctcgggcccgggcagcagcgccaggcggcggtgccggcgggtgctgtactggatcccggtggtgttcatcaccctcctgctcggctggtcctactacgcctacgccatccagctgtgcatagtgtccatggaaaacactggcgaacaagttgtgtgcctgatggcctatcatctactttttgcaatgtttgtctggtcatactggaaaactatctttacattaccaatgaatccttcaaaagaattccatctctcttatgcagagaaagatttgttggagagagagccaagaggagaagcccatcaggaagttcttaggcgagcagccaaggatcttcccatctataccaggaccatgtctggagccatccgatactgtgacagatgccaacttataaaaccagatcgctgccatcactgctccgtctgtgataaatgtattttgaagatggatcatcattgtccatgggtgaacaattgtgttggattttcaaattataagttctttctccttttcttggcttattctctgctctactgcctttttattgcggcaacagatttacagtattttatcaaattttggacaaatggcctacctgatactcaagccaagttccatattatgtttttattctttgctgcagctatgttttctgtcagcttgtcttctctgtttggctatcattgttggctagtcagcaaaaataaatctacattagaggcattcagaagtccagtatttcgacatggaacagataagaatggattcagcttgggtttcagtaaaaacatgcgacaagtttttggtgatgagaagaagtactggttgctacccattttttcaagtctaggtgatggctgctcctttccaacttgccttgttaaccaggatcctgaacaagcatctactcctgcagggctgaattccacagctaaaaatctcgaaaaccatcagtttcctgcaaagccattgagagagtcccagagccaccttcttactgattctcagtcttggacggagagcagcataaacccaggaaaatgcaaagctggtatgagcaatcctgcattaaccatggaaaatgagacttaa
Sequence Length
1104
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,022 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 2, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 2
NCBI Official Symbol
ZDHHC2
NCBI Official Synonym Symbols
DHHC2; ZNF372
NCBI Protein Information
palmitoyltransferase ZDHHC2
UniProt Protein Name
Palmitoyltransferase ZDHHC2
Protein Family
UniProt Gene Name
ZDHHC2
UniProt Synonym Gene Names
REAM; REC; ZNF372; Ream; Rec; DHHC-2
UniProt Entry Name
ZDHC2_HUMAN

Uniprot Description

ZDHHC2: Palmitoyltransferase specific for GAP43 and DLG4/PSD95. Mutations in ZDHHC2 are found in hepatocellular carcinoma and colorectal cancer. Belongs to the DHHC palmitoyltransferase family.

Protein type: EC 2.3.1.225; Membrane protein, integral; Membrane protein, multi-pass; Transferase

Chromosomal Location of Human Ortholog: 8p22

Cellular Component: endoplasmic reticulum; Golgi apparatus; plasma membrane

Molecular Function: palmitoyltransferase activity

Biological Process: cellular protein metabolic process; protein palmitoylation

Research Articles on ZDHHC2

Similar Products

Product Notes

The ZDHHC2 zdhhc2 (Catalog #AAA1271445) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccct cgggcccggg cagcagcgcc aggcggcggt gccggcgggt gctgtactgg atcccggtgg tgttcatcac cctcctgctc ggctggtcct actacgccta cgccatccag ctgtgcatag tgtccatgga aaacactggc gaacaagttg tgtgcctgat ggcctatcat ctactttttg caatgtttgt ctggtcatac tggaaaacta tctttacatt accaatgaat ccttcaaaag aattccatct ctcttatgca gagaaagatt tgttggagag agagccaaga ggagaagccc atcaggaagt tcttaggcga gcagccaagg atcttcccat ctataccagg accatgtctg gagccatccg atactgtgac agatgccaac ttataaaacc agatcgctgc catcactgct ccgtctgtga taaatgtatt ttgaagatgg atcatcattg tccatgggtg aacaattgtg ttggattttc aaattataag ttctttctcc ttttcttggc ttattctctg ctctactgcc tttttattgc ggcaacagat ttacagtatt ttatcaaatt ttggacaaat ggcctacctg atactcaagc caagttccat attatgtttt tattctttgc tgcagctatg ttttctgtca gcttgtcttc tctgtttggc tatcattgtt ggctagtcag caaaaataaa tctacattag aggcattcag aagtccagta tttcgacatg gaacagataa gaatggattc agcttgggtt tcagtaaaaa catgcgacaa gtttttggtg atgagaagaa gtactggttg ctacccattt tttcaagtct aggtgatggc tgctcctttc caacttgcct tgttaaccag gatcctgaac aagcatctac tcctgcaggg ctgaattcca cagctaaaaa tctcgaaaac catcagtttc ctgcaaagcc attgagagag tcccagagcc accttcttac tgattctcag tcttggacgg agagcagcat aaacccagga aaatgcaaag ctggtatgag caatcctgca ttaaccatgg aaaatgagac ttaa. It is sometimes possible for the material contained within the vial of "ZDHHC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.