Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZDHHC17 cdna clone

ZDHHC17 cDNA Clone

Gene Names
ZDHHC17; HIP3; HYPH; HIP14; HSPC294
Synonyms
ZDHHC17; ZDHHC17 cDNA Clone; ZDHHC17 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagcgggaggagggatttaacaccaagatggcggacggcccggatgagtacgataccgaagcgggctgtgtgccccttctccacccagaggaaatcaaaccccaaagccattataaccatggatatggtgaacctcttggacggaaaactcatattgatgattacagcacatgggacatagtcaaggctacacaatatggaatatatgaacgctgtcgagaattggtggaagcaggttatgatgtacggcaaccggacaaagaaaatgttaccctcctccattgggctgccatcaataacagaatagatttagtcaaatactatatttcgaaaggtgctattgtggatcaacttggaggggacctgaattcaactccattgcactgggccacaagacaaggccatctatccatggttgtgcaactaatgaaatatggtgcagatccttcattaattgatggagaaggatgtagctgtattcatctggctgctcagttcggacatacctcaattgttgcttatctcatagcaaaaggacaggatgtagatatgatggatcagaatggaatgacgcctttaatgtgggcagcatatagaacacatagtgtggatccaactagattgcttttaacattcaatgtttcagttaaccttggtgacaagtatcacaaaaacactgctctgcattgggcagtgctagcagggaataccacagtcattagccttcttctggaagctggagctaatgttgatgcccagaatatcaagggcgaatcagcgcttgatttggcaaaacagagaaaaaatgtgtggatgatcaaccacttacaagaggcaaggcaagcaaaaggatatgacaatccgtccttccttagaaagctgaaagctgataaggaatttcggcagaaagtaatgttaggaactcctttcctagttatttggctggttgggtttatagcagacctaaatattgattcttggctcattaaagggctaatgtatggtggtgtttgggctacagtacagtttctttcaaaatcctttttcgatcattcaatgcatagtgcattgccccttgggatatatttggcaaccaaattctggatgtatgtgacgtggttcttctggttttggaatgatctcaactttttatttatccatcttccattccttgccaatagtgttgcacttttctacaattttggaaaatcttggaaatcagatccagggattattaaagcaacagaagagcaaaagaaaaagacaatagttgaacttgcagagacaggaagtctggacctcagtatattctgcagtacctgtttgatacgaaaaccggtgaggtccaaacattgtggtgtgtgcaaccgctgtatagcaaaatttgatcatcattgcccatgggtgggtaactgtgtaggtgcaggcaaccatagatattttatgggctacctattcttcttgctttttatgatctgctggatgatttatggttgtatatcttactggggactccactgtgagaccacttacaccaaggatggattttggacatacattactcagattgccacgtgttcaccttggatgttttggatgttcctgaacagtgttttccacttcatgtgggtggctgtattactcatgtgtcagatgtaccagatatcatgtttaggtattactacaaatgaaagaatgaatgccaggagatacaagcactttaaagtcacaacaacgtctattgaaagcccattcaaccatggatgtgtaagaaatattatagacttctttgaatttcgatgctgtggcctctttcgtcctgttatcgtggactggaccaggcagtatacaatagaatatgaccaaatatcaggatctgggtaccagctggtgtag
Sequence Length
1899
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,845 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 17, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 17
NCBI Official Symbol
ZDHHC17
NCBI Official Synonym Symbols
HIP3; HYPH; HIP14; HSPC294
NCBI Protein Information
palmitoyltransferase ZDHHC17
UniProt Protein Name
Palmitoyltransferase ZDHHC17
Protein Family
UniProt Gene Name
ZDHHC17
UniProt Synonym Gene Names
DHHC-17
UniProt Entry Name
ZDH17_HUMAN

Uniprot Description

HIP14: a palmitoyltransferase specific for a subset of neuronal proteins, including SNAP25, PSD-95, GAD2, SYT1 and Huntingtin. May be involved in the sorting or targeting of critical proteins involved in the initiating events of endocytosis at the plasma membrane. May be involved in the NF-kappa-B signaling pathway. Can cause cellular transformation, and is up-regulated in a number of types of human tumors. Expressed in all brain regions. Expression is highest in the cortex, cerebellum, occipital lobe and caudate, and lowest in the spinal cord. Expression is also seen in testis, pancreas, heart and kidney. Three alternatively spliced isoforms have been described.

Protein type: Transferase; Membrane protein, multi-pass; EC 2.3.1.225; Tumor suppressor; Membrane protein, integral

Chromosomal Location of Human Ortholog: 12q21.2

Cellular Component: cytoplasm; Golgi apparatus; Golgi membrane; intracellular membrane-bound organelle

Molecular Function: identical protein binding; magnesium ion transmembrane transporter activity; palmitoyltransferase activity; protein binding; protein-cysteine S-palmitoleyltransferase activity; signal transducer activity

Biological Process: lipoprotein transport; positive regulation of I-kappaB kinase/NF-kappaB cascade; protein palmitoylation

Research Articles on ZDHHC17

Similar Products

Product Notes

The ZDHHC17 zdhhc17 (Catalog #AAA1267476) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagcggg aggagggatt taacaccaag atggcggacg gcccggatga gtacgatacc gaagcgggct gtgtgcccct tctccaccca gaggaaatca aaccccaaag ccattataac catggatatg gtgaacctct tggacggaaa actcatattg atgattacag cacatgggac atagtcaagg ctacacaata tggaatatat gaacgctgtc gagaattggt ggaagcaggt tatgatgtac ggcaaccgga caaagaaaat gttaccctcc tccattgggc tgccatcaat aacagaatag atttagtcaa atactatatt tcgaaaggtg ctattgtgga tcaacttgga ggggacctga attcaactcc attgcactgg gccacaagac aaggccatct atccatggtt gtgcaactaa tgaaatatgg tgcagatcct tcattaattg atggagaagg atgtagctgt attcatctgg ctgctcagtt cggacatacc tcaattgttg cttatctcat agcaaaagga caggatgtag atatgatgga tcagaatgga atgacgcctt taatgtgggc agcatataga acacatagtg tggatccaac tagattgctt ttaacattca atgtttcagt taaccttggt gacaagtatc acaaaaacac tgctctgcat tgggcagtgc tagcagggaa taccacagtc attagccttc ttctggaagc tggagctaat gttgatgccc agaatatcaa gggcgaatca gcgcttgatt tggcaaaaca gagaaaaaat gtgtggatga tcaaccactt acaagaggca aggcaagcaa aaggatatga caatccgtcc ttccttagaa agctgaaagc tgataaggaa tttcggcaga aagtaatgtt aggaactcct ttcctagtta tttggctggt tgggtttata gcagacctaa atattgattc ttggctcatt aaagggctaa tgtatggtgg tgtttgggct acagtacagt ttctttcaaa atcctttttc gatcattcaa tgcatagtgc attgcccctt gggatatatt tggcaaccaa attctggatg tatgtgacgt ggttcttctg gttttggaat gatctcaact ttttatttat ccatcttcca ttccttgcca atagtgttgc acttttctac aattttggaa aatcttggaa atcagatcca gggattatta aagcaacaga agagcaaaag aaaaagacaa tagttgaact tgcagagaca ggaagtctgg acctcagtat attctgcagt acctgtttga tacgaaaacc ggtgaggtcc aaacattgtg gtgtgtgcaa ccgctgtata gcaaaatttg atcatcattg cccatgggtg ggtaactgtg taggtgcagg caaccataga tattttatgg gctacctatt cttcttgctt tttatgatct gctggatgat ttatggttgt atatcttact ggggactcca ctgtgagacc acttacacca aggatggatt ttggacatac attactcaga ttgccacgtg ttcaccttgg atgttttgga tgttcctgaa cagtgttttc cacttcatgt gggtggctgt attactcatg tgtcagatgt accagatatc atgtttaggt attactacaa atgaaagaat gaatgccagg agatacaagc actttaaagt cacaacaacg tctattgaaa gcccattcaa ccatggatgt gtaagaaata ttatagactt ctttgaattt cgatgctgtg gcctctttcg tcctgttatc gtggactgga ccaggcagta tacaatagaa tatgaccaaa tatcaggatc tgggtaccag ctggtgtag. It is sometimes possible for the material contained within the vial of "ZDHHC17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.