Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZC3H10 cdna clone

ZC3H10 cDNA Clone

Gene Names
ZC3H10; ZC3HDC10
Synonyms
ZC3H10; ZC3H10 cDNA Clone; ZC3H10 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgaccgggacagctatgccaacggtaccgggagcagcggtggaggccctggaggtggtggcagcgaggaggccagtggggcaggggtaggcagtggcggggccagctcagatgccatctgtagagacttcttgaggaatgtgtgcaagcgaggcaagcgttgccgatatcgccacccagacatgagcgaggtgtccaacttgggggtgagcaaaaacgagttcatcttctgccatgacttccagaacaaggagtgtagccgcccaaattgccgtttcatccatggctccaaggaggatgaggatggctataagaagacaggagagcttcccccacggctgaggcagaaagtagcagctggccttggcctttcaccggctgacctaccaaatggcaaggaggaggtccctatctgccgtgactttctcaagggtgactgtcagagaggagccaagtgcaagttccgtcacctgcaacgggattttgagtttgatgctcggggtggaggaggcactggtgggggctcaacaggctcagtcctcccaggacgacgtcatgatctctatgatatctatgaccttcctgacaggggctttgaggaccatgagccaggcccaaaacgccggcgaggtggatgctgcccccctgatggccctcattttgagtcatatgaatatagtttggctccaccgcgaggggtggagtgcagactgctagaggaggagaatgccatgctcaggaagcgggtagaggagttaaagaagcaggtcagcaacctgctggccaccaatgaggtactactggaacaaaatgctcagttccgcaatcaggccaaggtcataaccctgagctccactgcaccagcgactgagcagactctggcccccactgtgggcactgttgccacttttaaccatggcattgcccagactcacactactctcagcagccaggctctacagcctcgtccagtgtcccagcaagaactggtggcccctgctggagctccagctgctcccccaactaatgctgcacctcctgctgctccaccacccccacccccacacttgaccccagagatcacgccactgtcagctgccctggctcaaacaattgcccagggaatggcacctccacctgtctccatggctcctgtggctgtatctgtggctcctgtggcccctgtggctgtatcgatggcccaacccttggcaggaatcacaatgagccacaccaccactcccatggtgacttaccctatcgcttcccagagcatgcgcatcacggccatgccacactga
Sequence Length
1305
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,052 Da
NCBI Official Full Name
Homo sapiens zinc finger CCCH-type containing 10, mRNA
NCBI Official Synonym Full Names
zinc finger CCCH-type containing 10
NCBI Official Symbol
ZC3H10
NCBI Official Synonym Symbols
ZC3HDC10
NCBI Protein Information
zinc finger CCCH domain-containing protein 10
UniProt Protein Name
Zinc finger CCCH domain-containing protein 10
UniProt Gene Name
ZC3H10
UniProt Synonym Gene Names
ZC3HDC10
UniProt Entry Name
ZC3HA_HUMAN

Uniprot Description

ZC3H10:

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 12q13.2

Molecular Function: protein binding

Research Articles on ZC3H10

Similar Products

Product Notes

The ZC3H10 zc3h10 (Catalog #AAA1278038) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgacc gggacagcta tgccaacggt accgggagca gcggtggagg ccctggaggt ggtggcagcg aggaggccag tggggcaggg gtaggcagtg gcggggccag ctcagatgcc atctgtagag acttcttgag gaatgtgtgc aagcgaggca agcgttgccg atatcgccac ccagacatga gcgaggtgtc caacttgggg gtgagcaaaa acgagttcat cttctgccat gacttccaga acaaggagtg tagccgccca aattgccgtt tcatccatgg ctccaaggag gatgaggatg gctataagaa gacaggagag cttcccccac ggctgaggca gaaagtagca gctggccttg gcctttcacc ggctgaccta ccaaatggca aggaggaggt ccctatctgc cgtgactttc tcaagggtga ctgtcagaga ggagccaagt gcaagttccg tcacctgcaa cgggattttg agtttgatgc tcggggtgga ggaggcactg gtgggggctc aacaggctca gtcctcccag gacgacgtca tgatctctat gatatctatg accttcctga caggggcttt gaggaccatg agccaggccc aaaacgccgg cgaggtggat gctgcccccc tgatggccct cattttgagt catatgaata tagtttggct ccaccgcgag gggtggagtg cagactgcta gaggaggaga atgccatgct caggaagcgg gtagaggagt taaagaagca ggtcagcaac ctgctggcca ccaatgaggt actactggaa caaaatgctc agttccgcaa tcaggccaag gtcataaccc tgagctccac tgcaccagcg actgagcaga ctctggcccc cactgtgggc actgttgcca cttttaacca tggcattgcc cagactcaca ctactctcag cagccaggct ctacagcctc gtccagtgtc ccagcaagaa ctggtggccc ctgctggagc tccagctgct cccccaacta atgctgcacc tcctgctgct ccaccacccc cacccccaca cttgacccca gagatcacgc cactgtcagc tgccctggct caaacaattg cccagggaat ggcacctcca cctgtctcca tggctcctgt ggctgtatct gtggctcctg tggcccctgt ggctgtatcg atggcccaac ccttggcagg aatcacaatg agccacacca ccactcccat ggtgacttac cctatcgctt cccagagcat gcgcatcacg gccatgccac actga. It is sometimes possible for the material contained within the vial of "ZC3H10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.