ZBTB45 cdna clone
ZBTB45 cDNA Clone
Gene Names
ZBTB45; ZNF499
Synonyms
ZBTB45; ZBTB45 cDNA Clone; ZBTB45 cdna clone
Sequence
atggcggctgcagaggctgtgcatcacatacacctgcagaacttctcacgctctctgcttgagaccctcaatgggcagaggcttgggggacacttctgtgacgtgactgtgcgcattcgtgaagcttcgctgcgtgcccaccgctgcgtgctggcggccggctcacccttcttccaagacaagctgctgctcggccactctgagatccgtgtgcctccggtggtgcccgcgcagacagtgcgacagctggtagagttcctgtacagcggttcgctcgttgtggcgcagggtgaagccctgcaggtgctcacggccgcgtcagtgcttcgcatacagacagttatcgacgaatgcacgcagattatcgcccgcgctcgagccccgggcacctctgcgcccacgcccctgcccacccctgtgcccccgccactcgcacctgcgcagctgcgtcaccgcctgcgccacctgctggctgcacgtcccccggggcaccccggtgctgcacacagccgtaagcagcgccagcccgcgcgtttgcagctgccagcgcccccaacacctgccaaggctgaggggcctgatgctgacccctcactgtccgcggcccctgatgaccgaggtgacgaggatgacgaggaaagtgacgatgagaccgatggcgaggatggcgaaggtggcggcccaggcgagggccaggcacctccttccttcccagactgtgctgctggcttcctcactgctgctgctgacagcgcgtgcgaggagccccctgcacccactggcctcgctgactacagtggtgccgggagagattttcttcggggagctgggtcagctgaggacgtatttccagacagctatgtatccacttggcacgacgaggatggcgctgtccccgaaggctgtcccactgagacccctgtccagcccgactgcatactgtctggatcccgcccgcctggtgtgaagaccccagggccgcccgttgcactcttcccctttcacttgggtgcccctgggccacccgcaccacccccttcagcaccatcggggccagcccctgcgcccccacccgccttctaccccacactccagcccgaggcagcccccagtactcagctgggggaggtcccggctccctctgctgctcccaccacggccccctcaggcacccctgctcgcaccccaggtgctgagccacctacgtatgagtgcagccactgtcgcaagacgttcagctcccggaaaaactacaccaagcacatgttcatccactcgggggagaagccgcaccagtgcgccgtgtgctggcgatccttctctctacgcgactacctgctcaaacacatggtcacgcacaccggcgtgcgcgccttccagtgcgccgtctgcgccaagcgcttcacgcagaagagctcgctcaacgtgcacatgcgcactcaccggcccgagcgcgcgccctgccccgcctgcggcaaggtcttctcgcaccgcgcgctgctggagcgccacctggcggcgcaccctgcgccctga
Sequence Length
1536
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,008 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 45, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 45
NCBI Official Symbol
ZBTB45
NCBI Official Synonym Symbols
ZNF499
NCBI Protein Information
zinc finger and BTB domain-containing protein 45
UniProt Protein Name
Zinc finger and BTB domain-containing protein 45
Protein Family
UniProt Gene Name
ZBTB45
UniProt Synonym Gene Names
ZNF499
UniProt Entry Name
ZBT45_HUMAN
Uniprot Description
ZBTB45: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 19q13.43
Similar Products
Product Notes
The ZBTB45 zbtb45 (Catalog #AAA1273163) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg cagaggctgt gcatcacata cacctgcaga acttctcacg ctctctgctt gagaccctca atgggcagag gcttggggga cacttctgtg acgtgactgt gcgcattcgt gaagcttcgc tgcgtgccca ccgctgcgtg ctggcggccg gctcaccctt cttccaagac aagctgctgc tcggccactc tgagatccgt gtgcctccgg tggtgcccgc gcagacagtg cgacagctgg tagagttcct gtacagcggt tcgctcgttg tggcgcaggg tgaagccctg caggtgctca cggccgcgtc agtgcttcgc atacagacag ttatcgacga atgcacgcag attatcgccc gcgctcgagc cccgggcacc tctgcgccca cgcccctgcc cacccctgtg cccccgccac tcgcacctgc gcagctgcgt caccgcctgc gccacctgct ggctgcacgt cccccggggc accccggtgc tgcacacagc cgtaagcagc gccagcccgc gcgtttgcag ctgccagcgc ccccaacacc tgccaaggct gaggggcctg atgctgaccc ctcactgtcc gcggcccctg atgaccgagg tgacgaggat gacgaggaaa gtgacgatga gaccgatggc gaggatggcg aaggtggcgg cccaggcgag ggccaggcac ctccttcctt cccagactgt gctgctggct tcctcactgc tgctgctgac agcgcgtgcg aggagccccc tgcacccact ggcctcgctg actacagtgg tgccgggaga gattttcttc ggggagctgg gtcagctgag gacgtatttc cagacagcta tgtatccact tggcacgacg aggatggcgc tgtccccgaa ggctgtccca ctgagacccc tgtccagccc gactgcatac tgtctggatc ccgcccgcct ggtgtgaaga ccccagggcc gcccgttgca ctcttcccct ttcacttggg tgcccctggg ccacccgcac cacccccttc agcaccatcg gggccagccc ctgcgccccc acccgccttc taccccacac tccagcccga ggcagccccc agtactcagc tgggggaggt cccggctccc tctgctgctc ccaccacggc cccctcaggc acccctgctc gcaccccagg tgctgagcca cctacgtatg agtgcagcca ctgtcgcaag acgttcagct cccggaaaaa ctacaccaag cacatgttca tccactcggg ggagaagccg caccagtgcg ccgtgtgctg gcgatccttc tctctacgcg actacctgct caaacacatg gtcacgcaca ccggcgtgcg cgccttccag tgcgccgtct gcgccaagcg cttcacgcag aagagctcgc tcaacgtgca catgcgcact caccggcccg agcgcgcgcc ctgccccgcc tgcggcaagg tcttctcgca ccgcgcgctg ctggagcgcc acctggcggc gcaccctgcg ccctga. It is sometimes possible for the material contained within the vial of "ZBTB45, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
