Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

YES1 cdna clone

YES1 cDNA Clone

Gene Names
YES1; Yes; c-yes; HsT441; P61-YES
Synonyms
YES1; YES1 cDNA Clone; YES1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctgcattaaaagtaaagaaaacaaaagtccagccattaaatacagacctgaaaatactccagagcctgtcagtacaagtgtgagccattatggagcagaacccactacagtgtcaccatgtccgtcatcttcagcaaagggaacagcagttaatttcagcagtctttccatgacaccatttggaggatcctcaggggtaacgccttttggaggtgcatcttcctcattttcagtggtgccaagttcatatcctgctggtttaacaggtggtgttactatatttgtggccttatatgattatgaagctagaactacagaagacctttcatttaagaagggtgaaagatttcaaataattaacaatacggaaggagattggtgggaagcaagatcaatcgctacaggaaagaatggttatatcccgagcaattatgtagcgcctgcagattccattcaggcagaagaatggtattttggcaaaatggggagaaaagatgctgaaagattacttttgaatcctggaaatcaacgaggtattttcttagtaagagagagtgaaacaactaaaggtgcttattccctttctattcgtgattgggatgagataaggggtgacaatgtgaaacactacaaaattaggaaacttgacaatggtggatactatatcacaaccagagcacaatttgatactctgcagaaattggtgaaacactacacagaacatgctgatggtttatgccacaagttgacaactgtgtgtccaactgtgaaacctcagactcaaggtctagcaaaagatgcttgggaaatccctcgagaatctttgcgactagaggttaaactaggacaaggatgtttcggcgaagtgtggatgggaacatggaatggaaccacgaaagtagcaatcaaaacactaaaaccaggtacaatgatgccagaagctttccttcaagaagctcagataatgaaaaaattaagacatgataaacttgttccactatatgctgttgtttctgaagaaccaatttacattgtcactgaatttatgtcaaaaggaagcttattagatttccttaaggaaggagatggaaagtatttgaagcttccacagctggttgatatggctgctcagattgctgatggtatggcatatattgaaagaatgaactatattcaccgagatcttcgggctgctaatattcttgtaggagaaaatcttgtgtgcaaaatagcagactttggtttagcaaggttaattgaagacaatgaatacacagcaagacaaggtgcaaaatttccaatcaaatggacagctcctgaagctgcactgtatggtcggtttacaataaagtctgatgtctggtcatttggaattctgcaaacagaactagtaacaaagggccgagtgccatatccaggtatggtgaaccgtgaagtactagaacaagtggagcgaggatacaggatgccgtgccctcagggctgtccagaatccctccatgaattgatgaatctgtgttggaagaaggaccctgatgaaagaccaacatttgaatatattcagtccttcttggaagactacttcactgctacagagccacagtaccagccaggagaaaatttataa
Sequence Length
1632
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,801 Da
NCBI Official Full Name
Homo sapiens v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1, mRNA
NCBI Official Synonym Full Names
YES proto-oncogene 1, Src family tyrosine kinase
NCBI Official Symbol
YES1
NCBI Official Synonym Symbols
Yes; c-yes; HsT441; P61-YES
NCBI Protein Information
tyrosine-protein kinase Yes
UniProt Protein Name
Tyrosine-protein kinase Yes
Protein Family
UniProt Gene Name
YES1
UniProt Synonym Gene Names
YES
UniProt Entry Name
YES_HUMAN

NCBI Description

This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]

Uniprot Description

Yes: a proto-oncogenic cytosolic tyrosine kinase of the Src family. Expressed at high levels in adult neurons, spermatozoa, platelets, and epithelial cells.

Protein type: EC 2.7.10.2; Protein kinase, tyrosine (non-receptor); Protein kinase, TK; Kinase, protein; Oncoprotein; TK group; Src family

Chromosomal Location of Human Ortholog: 18p11.31-p11.21

Cellular Component: cytoplasm; cytosol; extrinsic to internal side of plasma membrane; focal adhesion; Golgi apparatus; plasma membrane

Molecular Function: enzyme binding; non-membrane spanning protein tyrosine kinase activity; protein binding; protein-tyrosine kinase activity; receptor binding

Biological Process: cell differentiation; ephrin receptor signaling pathway; innate immune response; leukocyte migration; protein modification process; regulation of cell proliferation; regulation of vascular permeability; T cell costimulation; transmembrane receptor protein tyrosine kinase signaling pathway

Research Articles on YES1

Similar Products

Product Notes

The YES1 yes1 (Catalog #AAA1270377) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctgca ttaaaagtaa agaaaacaaa agtccagcca ttaaatacag acctgaaaat actccagagc ctgtcagtac aagtgtgagc cattatggag cagaacccac tacagtgtca ccatgtccgt catcttcagc aaagggaaca gcagttaatt tcagcagtct ttccatgaca ccatttggag gatcctcagg ggtaacgcct tttggaggtg catcttcctc attttcagtg gtgccaagtt catatcctgc tggtttaaca ggtggtgtta ctatatttgt ggccttatat gattatgaag ctagaactac agaagacctt tcatttaaga agggtgaaag atttcaaata attaacaata cggaaggaga ttggtgggaa gcaagatcaa tcgctacagg aaagaatggt tatatcccga gcaattatgt agcgcctgca gattccattc aggcagaaga atggtatttt ggcaaaatgg ggagaaaaga tgctgaaaga ttacttttga atcctggaaa tcaacgaggt attttcttag taagagagag tgaaacaact aaaggtgctt attccctttc tattcgtgat tgggatgaga taaggggtga caatgtgaaa cactacaaaa ttaggaaact tgacaatggt ggatactata tcacaaccag agcacaattt gatactctgc agaaattggt gaaacactac acagaacatg ctgatggttt atgccacaag ttgacaactg tgtgtccaac tgtgaaacct cagactcaag gtctagcaaa agatgcttgg gaaatccctc gagaatcttt gcgactagag gttaaactag gacaaggatg tttcggcgaa gtgtggatgg gaacatggaa tggaaccacg aaagtagcaa tcaaaacact aaaaccaggt acaatgatgc cagaagcttt ccttcaagaa gctcagataa tgaaaaaatt aagacatgat aaacttgttc cactatatgc tgttgtttct gaagaaccaa tttacattgt cactgaattt atgtcaaaag gaagcttatt agatttcctt aaggaaggag atggaaagta tttgaagctt ccacagctgg ttgatatggc tgctcagatt gctgatggta tggcatatat tgaaagaatg aactatattc accgagatct tcgggctgct aatattcttg taggagaaaa tcttgtgtgc aaaatagcag actttggttt agcaaggtta attgaagaca atgaatacac agcaagacaa ggtgcaaaat ttccaatcaa atggacagct cctgaagctg cactgtatgg tcggtttaca ataaagtctg atgtctggtc atttggaatt ctgcaaacag aactagtaac aaagggccga gtgccatatc caggtatggt gaaccgtgaa gtactagaac aagtggagcg aggatacagg atgccgtgcc ctcagggctg tccagaatcc ctccatgaat tgatgaatct gtgttggaag aaggaccctg atgaaagacc aacatttgaa tatattcagt ccttcttgga agactacttc actgctacag agccacagta ccagccagga gaaaatttat aa. It is sometimes possible for the material contained within the vial of "YES1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.