Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VPS72 cdna clone

VPS72 cDNA Clone

Gene Names
VPS72; YL1; CFL1; Swc2; YL-1; TCFL1
Synonyms
VPS72; VPS72 cDNA Clone; VPS72 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtttggctgggggccgggcaccccggaagaccgctgggaaccggctttctgggcttttggaggcagaggaggaagatgagttctaccagacgacttatgggggtttcacagaggaatccggagatgatgagtatcaaggggaccagtcagacacagaggacgaagtggactctgactttgacattgatgaaggggatgaaccatccagtgatggagaagcagaagagccaagaaggaagcgccgagtagtcaccaaggcctataaggaacctctcaagagcttaaggcctcgaaaggtcaacaccccggctggtagctctcagaaggcgcgagaagagaaggcactactgccattagaactacaagatgacggctctgacagtcggaagtctatgcgtcagtctacagctgagcatacacgacaaacgttccttcgggtacaggagaggcagggccagtcaagacggcgaaaggggccccactgtgagcggccactaacccaggaggaactgctccgggaggccaagatcacagaagagcttaatttacggtcactggagacatatgagcggctcgaggctgataaaaagaagcaggttcataagaagcggaagtgccccgggcccataatcacctatcattcagtgacagtgccacttgttggggagccaggccccaaggaagagaacgttgacatagaaggacttgatcctgctccctcggtgtctgcattgactcctcatgctgggactggacccgtcaacccccctgctcgctgctcacgtaccttcatcacttttagtgatgatgcaactttcgaggaatggttcccccaagggcggcccccaaaagtccctgttcgtgaggtctgtccagtgacccatcgtccagccctataccgggaccctgttacagacataccctatgccactgctcgagccttcaagatcattcgtgaggcttacaagaagtacattactgcccatggactgccgcccactgcctcagccctgggccccggcccgccacctcctgagcccctccctggctctgggccccgagccttgcgccagaaaattgtcattaaatga
Sequence Length
1095
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,848 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 72 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
vacuolar protein sorting 72 homolog
NCBI Official Symbol
VPS72
NCBI Official Synonym Symbols
YL1; CFL1; Swc2; YL-1; TCFL1
NCBI Protein Information
vacuolar protein sorting-associated protein 72 homolog
UniProt Protein Name
Vacuolar protein sorting-associated protein 72 homolog
UniProt Gene Name
VPS72
UniProt Synonym Gene Names
TCFL1; YL1
UniProt Entry Name
VPS72_HUMAN

NCBI Description

The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]

Uniprot Description

VPS72: Could be a DNA-binding transcriptional regulator. May be involved in chromatin modification and remodeling. Belongs to the VPS72/YL1 family.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 1q21

Cellular Component: nucleoplasm; nucleus; protein complex

Molecular Function: protein binding

Biological Process: histone exchange; negative regulation of transcription from RNA polymerase II promoter

Research Articles on VPS72

Similar Products

Product Notes

The VPS72 vps72 (Catalog #AAA1269098) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtttgg ctgggggccg ggcaccccgg aagaccgctg ggaaccggct ttctgggctt ttggaggcag aggaggaaga tgagttctac cagacgactt atgggggttt cacagaggaa tccggagatg atgagtatca aggggaccag tcagacacag aggacgaagt ggactctgac tttgacattg atgaagggga tgaaccatcc agtgatggag aagcagaaga gccaagaagg aagcgccgag tagtcaccaa ggcctataag gaacctctca agagcttaag gcctcgaaag gtcaacaccc cggctggtag ctctcagaag gcgcgagaag agaaggcact actgccatta gaactacaag atgacggctc tgacagtcgg aagtctatgc gtcagtctac agctgagcat acacgacaaa cgttccttcg ggtacaggag aggcagggcc agtcaagacg gcgaaagggg ccccactgtg agcggccact aacccaggag gaactgctcc gggaggccaa gatcacagaa gagcttaatt tacggtcact ggagacatat gagcggctcg aggctgataa aaagaagcag gttcataaga agcggaagtg ccccgggccc ataatcacct atcattcagt gacagtgcca cttgttgggg agccaggccc caaggaagag aacgttgaca tagaaggact tgatcctgct ccctcggtgt ctgcattgac tcctcatgct gggactggac ccgtcaaccc ccctgctcgc tgctcacgta ccttcatcac ttttagtgat gatgcaactt tcgaggaatg gttcccccaa gggcggcccc caaaagtccc tgttcgtgag gtctgtccag tgacccatcg tccagcccta taccgggacc ctgttacaga cataccctat gccactgctc gagccttcaa gatcattcgt gaggcttaca agaagtacat tactgcccat ggactgccgc ccactgcctc agccctgggc cccggcccgc cacctcctga gcccctccct ggctctgggc cccgagcctt gcgccagaaa attgtcatta aatga. It is sometimes possible for the material contained within the vial of "VPS72, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.