Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UCN cdna clone

UCN cDNA Clone

Gene Names
UCN; UI; UROC
Synonyms
UCN; UCN cDNA Clone; UCN cdna clone
Ordering
For Research Use Only!
Sequence
ATGAGGCAGGCGGGACGCGCAGCGCTGCTGGCCGCGCTGCTGCTCCTGGTACAGCTGTGCCCTGGGAGCAGCCAGAGGAGCCCCGAGGCGGCCGGGGTCCAGGACCCGAGTCTGCGCTGGAGCCCCGGGGCACGGAACCAGGGTGGCGGGGCCCGCGCGCTCCTCTTGCTGCTGGCGGAGCGCTTCCCGCGCCGCGCGGGGCCCGGCCGATTGGGACTCGGGACGGCAGGCGAGCGGCCGCGGCGGGACAACCCTTCTCTGTCCATTGACCTCACCTTTCACCTGCTGCGGACCCTGCTGGAGCTGGCGCGGACGCAGAGCCAGCGGGAGCGCGCCGAGCAGAACCGCATCATATTCGACTCGGTGGGCAAGTGA
Sequence Length
375
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,458 Da
NCBI Official Full Name
Homo sapiens urocortin, mRNA
NCBI Official Synonym Full Names
urocortin
NCBI Official Symbol
UCN
NCBI Official Synonym Symbols
UI; UROC
NCBI Protein Information
urocortin
UniProt Protein Name
Urocortin
Protein Family
UniProt Gene Name
UCN
UniProt Entry Name
UCN1_HUMAN

NCBI Description

This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family. The encoded preproprotein is proteolytically processed to generate the mature peptide, an endogenous ligand for both corticotropin-releasing factor receptor 1 and corticotropin-releasing factor receptor 2. In the brain this peptide may be responsible for the effects of stress on appetite. This peptide may also play a role in mood disorders, neurodegeneration, and skeletal system disorders. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin-2. [provided by RefSeq, Feb 2016]

Uniprot Description

UCN: Acts in vitro to stimulate the secretion of adrenocorticotropic hormone (ACTH). Binds with high affinity to CRF receptor types 1, 2-alpha, and 2-beta. Belongs to the sauvagine/corticotropin-releasing factor/urotensin I family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 2p23.3

Cellular Component: extracellular space

Molecular Function: adrenocorticotropin-releasing hormone activity; neuropeptide hormone activity; protein binding

Biological Process: G-protein coupled receptor protein signaling pathway; negative regulation of hormone secretion

Research Articles on UCN

Similar Products

Product Notes

The UCN ucn (Catalog #AAA1277591) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAGGCAGG CGGGACGCGC AGCGCTGCTG GCCGCGCTGC TGCTCCTGGT ACAGCTGTGC CCTGGGAGCA GCCAGAGGAG CCCCGAGGCG GCCGGGGTCC AGGACCCGAG TCTGCGCTGG AGCCCCGGGG CACGGAACCA GGGTGGCGGG GCCCGCGCGC TCCTCTTGCT GCTGGCGGAG CGCTTCCCGC GCCGCGCGGG GCCCGGCCGA TTGGGACTCG GGACGGCAGG CGAGCGGCCG CGGCGGGACA ACCCTTCTCT GTCCATTGAC CTCACCTTTC ACCTGCTGCG GACCCTGCTG GAGCTGGCGC GGACGCAGAG CCAGCGGGAG CGCGCCGAGC AGAACCGCAT CATATTCGAC TCGGTGGGCA AGTGA. It is sometimes possible for the material contained within the vial of "UCN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.