Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TUSC3 cdna clone

TUSC3 cDNA Clone

Gene Names
TUSC3; M33; N33; MRT7; MRT22; OST3A; D8S1992
Synonyms
TUSC3; TUSC3 cDNA Clone; TUSC3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggcccggggcgctccttcacgccgtaggcaagcggggcggcggctgcggtacctgcccaccgggagctttcccttccttctcctgctgctgctgctctgcatccagctcgggggaggacagaagaaaaaggagaatcttttagctgaaaaagtagagcagctgatggaatggagttccagacgctcaatcttccgaatgaatggtgataaattccgaaaatttataaaggcaccacctcgaaactattccatgattgttatgttcactgctcttcagcctcagcggcagtgttctgtgtgcaggcaagctaatgaagaatatcaaatactggcgaactcctggcgctattcatctgctttttgtaacaagctcttcttcagtatggtggactatgatgaggggacagacgtttttcagcagctcaacatgaactctgctcctacattcatgcattttcctccaaaaggcagacctaagagagctgatacttttgacctccaaagaattggatttgcagctgagcaactagcaaagtggattgctgacagaacggatgttcatattcgggttttcagaccacccaactactctggtaccattgctttggccctgttagtgtcgcttgttggaggtttgctttatttgagaaggaacaacttggagttcatctataacaagactggttgggccatggtgtctctgtgtatagtctttgctatgacttctggccagatgtggaaccatatccgtggacctccatatgctcataagaacccacacaatggacaagtgagctacattcatgggagcagccaggctcagtttgtggcagaatcacacattattctggtactgaatgccgctatcaccatggggatggttcttctaaatgaagcagcaacttcgaaaggcgatgttggaaaaagacggataatttgcctagtgggattgggcctggtggtcttcttcttcagttttctactttcaatatttcgttccaagtaccacggctatccttatagctttttaattaaatga
Sequence Length
1044
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,558 Da
NCBI Official Full Name
Homo sapiens tumor suppressor candidate 3, mRNA
NCBI Official Synonym Full Names
tumor suppressor candidate 3
NCBI Official Symbol
TUSC3
NCBI Official Synonym Symbols
M33; N33; MRT7; MRT22; OST3A; D8S1992
NCBI Protein Information
tumor suppressor candidate 3
UniProt Protein Name
Tumor suppressor candidate 3
UniProt Gene Name
TUSC3
UniProt Synonym Gene Names
N33
UniProt Entry Name
TUSC3_HUMAN

NCBI Description

This gene is a candidate tumor suppressor gene. It is located within a homozygously deleted region of a metastatic prostate cancer. The gene is expressed in most nonlymphoid human tissues including prostate, lung, liver, and colon. Expression was also detected in many epithelial tumor cell lines. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

TUSC3: Magnesium transporter. May be involved in N- glycosylation through its association with N-oligosaccharyl transferase. Defects in TUSC3 are the cause of mental retardation autosomal recessive type 7 (MRT7); also known as mental retardation non-syndromic autosomal recessive 7. Mental retardation is characterized by significantly sub-average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. Non- syndromic mental retardation patients do not manifest other clinical signs. Belongs to the OST3/OST6 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 8p22

Cellular Component: endoplasmic reticulum membrane; mitochondrion; oligosaccharyl transferase complex; plasma membrane

Molecular Function: dolichyl-diphosphooligosaccharide-protein glycotransferase activity; magnesium ion transmembrane transporter activity

Biological Process: cognition; magnesium ion transport; protein amino acid N-linked glycosylation via asparagine; transmembrane transport

Disease: Mental Retardation, Autosomal Recessive 7

Research Articles on TUSC3

Similar Products

Product Notes

The TUSC3 tusc3 (Catalog #AAA1270638) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggccc ggggcgctcc ttcacgccgt aggcaagcgg ggcggcggct gcggtacctg cccaccggga gctttccctt ccttctcctg ctgctgctgc tctgcatcca gctcggggga ggacagaaga aaaaggagaa tcttttagct gaaaaagtag agcagctgat ggaatggagt tccagacgct caatcttccg aatgaatggt gataaattcc gaaaatttat aaaggcacca cctcgaaact attccatgat tgttatgttc actgctcttc agcctcagcg gcagtgttct gtgtgcaggc aagctaatga agaatatcaa atactggcga actcctggcg ctattcatct gctttttgta acaagctctt cttcagtatg gtggactatg atgaggggac agacgttttt cagcagctca acatgaactc tgctcctaca ttcatgcatt ttcctccaaa aggcagacct aagagagctg atacttttga cctccaaaga attggatttg cagctgagca actagcaaag tggattgctg acagaacgga tgttcatatt cgggttttca gaccacccaa ctactctggt accattgctt tggccctgtt agtgtcgctt gttggaggtt tgctttattt gagaaggaac aacttggagt tcatctataa caagactggt tgggccatgg tgtctctgtg tatagtcttt gctatgactt ctggccagat gtggaaccat atccgtggac ctccatatgc tcataagaac ccacacaatg gacaagtgag ctacattcat gggagcagcc aggctcagtt tgtggcagaa tcacacatta ttctggtact gaatgccgct atcaccatgg ggatggttct tctaaatgaa gcagcaactt cgaaaggcga tgttggaaaa agacggataa tttgcctagt gggattgggc ctggtggtct tcttcttcag ttttctactt tcaatatttc gttccaagta ccacggctat ccttatagct ttttaattaa atga. It is sometimes possible for the material contained within the vial of "TUSC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.