Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM15 cdna clone

TRIM15 cDNA Clone

Gene Names
TRIM15; RNF93; ZNFB7; ZNF178
Synonyms
TRIM15; TRIM15 cDNA Clone; TRIM15 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccgcaaccccgtccctgaaggtggtccatgagctgcctgcctgtaccctctgtgcggggccgctggaggatgcggtgaccattccctgtggacacaccttctgccggctctgcctccccgcgctctcccagatgggggcccaatcctcgggcaagatcctgctctgcccgctctgccaagaggaggagcaggcagagactcccatggcccctgtgcccctgggcccgctgggagaaacttactgcgaggagcacggcgagaagatctacttcttctgcgagaacgatgccgagttcctctgtgtgttctgcagggagggtcccacgcaccaggcgcacaccgtggggttcctggacgaggccattcagccctaccgggatcgtctcaggagtcgactggaagctctgagcacggagagagatgagattgaggatgtaaagtgtcaagaagaccagaagcttcaagtgctgctgactcagatcgaaagcaagaagcatcaggtggaaacagcttttgagaggctgcagcaggagctggagcagcagcgatgtctcctgctggccaggctgagggagctggagcagcagatttggaaggagagggatgaatatatcacaaaggtctctgaggaagtcacccggcttggagcccaggtcaaggagctggaggagaagtgtcagcagccagcaagtgagcttctacaagatgtcagagtcaaccagagcaggtgtgagatgaagacttttgtgagtcctgaggccatttctcctgaccttgtcaagaagatccgtgatttccacaggaaaatactcaccctcccagagatgatgaggatgttctcagaaaacttggcgcatcatctggaaatagattcaggggtcatcactctggaccctcagaccgccagccggagcctggttctctcggaagacaggaagtcagtgaggtacacccggcagaagaagaacctgccagacagccccctgcgcttcgacggcctcccggcggttctgggcttcccgggcttctcctccgggcgccaccgctggcaggttgacctgcagctgggcgacggcggcggctgcacggtgggggtggccggggagggggtgaggaggaagggagagatgggactcagcgccgaggacggcgtctgggccgtgatcatctcgcaccagcagtgctgggccagcacctccccgggcaccgacctgccgctgagcgagatcccgcgcggcgtgagagtcgccctggactacgaggcggggcaggtgaccctccacaacgcccagacccaggagcccatcttcaccttcactgcctctttctccggcaaagtcttccctttctttgccgtctggaaaaaaggttcctgccttacgctgaaaggctga
Sequence Length
1398
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,315 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 15, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 15
NCBI Official Symbol
TRIM15
NCBI Official Synonym Symbols
RNF93; ZNFB7; ZNF178
NCBI Protein Information
tripartite motif-containing protein 15
UniProt Protein Name
Tripartite motif-containing protein 15
UniProt Gene Name
TRIM15
UniProt Synonym Gene Names
RNF93; ZNF178; ZNFB7
UniProt Entry Name
TRI15_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIM15: is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Protein type: Ubiquitin conjugating system; Cell development/differentiation

Chromosomal Location of Human Ortholog: 6p21.3

Molecular Function: protein binding

Biological Process: activation of NF-kappaB transcription factor; innate immune response; mesodermal cell fate determination; positive regulation of interferon type I production; positive regulation of transcription factor activity

Research Articles on TRIM15

Similar Products

Product Notes

The TRIM15 trim15 (Catalog #AAA1278337) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccgcaa ccccgtccct gaaggtggtc catgagctgc ctgcctgtac cctctgtgcg gggccgctgg aggatgcggt gaccattccc tgtggacaca ccttctgccg gctctgcctc cccgcgctct cccagatggg ggcccaatcc tcgggcaaga tcctgctctg cccgctctgc caagaggagg agcaggcaga gactcccatg gcccctgtgc ccctgggccc gctgggagaa acttactgcg aggagcacgg cgagaagatc tacttcttct gcgagaacga tgccgagttc ctctgtgtgt tctgcaggga gggtcccacg caccaggcgc acaccgtggg gttcctggac gaggccattc agccctaccg ggatcgtctc aggagtcgac tggaagctct gagcacggag agagatgaga ttgaggatgt aaagtgtcaa gaagaccaga agcttcaagt gctgctgact cagatcgaaa gcaagaagca tcaggtggaa acagcttttg agaggctgca gcaggagctg gagcagcagc gatgtctcct gctggccagg ctgagggagc tggagcagca gatttggaag gagagggatg aatatatcac aaaggtctct gaggaagtca cccggcttgg agcccaggtc aaggagctgg aggagaagtg tcagcagcca gcaagtgagc ttctacaaga tgtcagagtc aaccagagca ggtgtgagat gaagactttt gtgagtcctg aggccatttc tcctgacctt gtcaagaaga tccgtgattt ccacaggaaa atactcaccc tcccagagat gatgaggatg ttctcagaaa acttggcgca tcatctggaa atagattcag gggtcatcac tctggaccct cagaccgcca gccggagcct ggttctctcg gaagacagga agtcagtgag gtacacccgg cagaagaaga acctgccaga cagccccctg cgcttcgacg gcctcccggc ggttctgggc ttcccgggct tctcctccgg gcgccaccgc tggcaggttg acctgcagct gggcgacggc ggcggctgca cggtgggggt ggccggggag ggggtgagga ggaagggaga gatgggactc agcgccgagg acggcgtctg ggccgtgatc atctcgcacc agcagtgctg ggccagcacc tccccgggca ccgacctgcc gctgagcgag atcccgcgcg gcgtgagagt cgccctggac tacgaggcgg ggcaggtgac cctccacaac gcccagaccc aggagcccat cttcaccttc actgcctctt tctccggcaa agtcttccct ttctttgccg tctggaaaaa aggttcctgc cttacgctga aaggctga. It is sometimes possible for the material contained within the vial of "TRIM15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.