TPRXL cdna clone
TPRXL cDNA Clone
Gene Names
TPRXL; TPRX3P
Synonyms
TPRXL; TPRXL cDNA Clone; TPRXL cdna clone
Sequence
atgacacacgacaagagctggcggagatgctcaatctcagggagtaccaagtgcaggtgtggttcaagaatcgccgggccaaacgctctcgggagcggtggttccagaagcagctccagcagctccagaagcatcctcagcagcagcatcctcagcagcagcatccccagcagcagctccagcagcagcagccccagcagcagccacagcagcagcagccccagcagcagccacagcagcagcagccccagcagcagcagctccaccagcagccccagtagcagctctagcagcagcagcagcagccccagcagcagcaactccagtagcagctccagcagcagcagccccagcagtagctccagcagcagcagcagcagccccagtagcagctccagcagccccagtagcagctccagcagcagcagcagcagccccagtagcagctccagcagccccagtagcagctctagcagcagcagctccagcagcagcagtcccagcagcagcagccccagtagcagcggcagcagccccagtagcagcaacagcagccccagtagtagcagcagcagccccagtagcagcagcagcagccccagcccccgtagcagcagccccagcagcagcagctccagcaccagcagtcccagcaccagcagtcccagcagcagcagtcccagcagcagcagccccagcagcagctgccccagtgcagccctgggcaggaggccacagagcccacagagctcgcactgtgccccctttccctga
Sequence Length
774
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,139 Da
NCBI Official Full Name
Homo sapiens tetra-peptide repeat homeobox-like, mRNA
NCBI Official Synonym Full Names
tetrapeptide repeat homeobox like
NCBI Official Symbol
TPRXL
NCBI Official Synonym Symbols
TPRX3P
UniProt Protein Name
Putative protein TPRXL
Protein Family
UniProt Gene Name
TPRXL
UniProt Entry Name
TPRXL_HUMAN
NCBI Description
Homeobox genes encode DNA-binding proteins, many of which are thought to be involved in early embryonic development. Homeobox genes encode a DNA-binding domain of 60 to 63 amino acids referred to as the homeodomain. This pseudogene is a member of the TPRX homeobox gene family. [provided by RefSeq, Jul 2008]
Uniprot Description
TPRXL:
Chromosomal Location of Human Ortholog: 3p25.1
Similar Products
Product Notes
The TPRXL tprxl (Catalog #AAA1265956) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacacacg acaagagctg gcggagatgc tcaatctcag ggagtaccaa gtgcaggtgt ggttcaagaa tcgccgggcc aaacgctctc gggagcggtg gttccagaag cagctccagc agctccagaa gcatcctcag cagcagcatc ctcagcagca gcatccccag cagcagctcc agcagcagca gccccagcag cagccacagc agcagcagcc ccagcagcag ccacagcagc agcagcccca gcagcagcag ctccaccagc agccccagta gcagctctag cagcagcagc agcagcccca gcagcagcaa ctccagtagc agctccagca gcagcagccc cagcagtagc tccagcagca gcagcagcag ccccagtagc agctccagca gccccagtag cagctccagc agcagcagca gcagccccag tagcagctcc agcagcccca gtagcagctc tagcagcagc agctccagca gcagcagtcc cagcagcagc agccccagta gcagcggcag cagccccagt agcagcaaca gcagccccag tagtagcagc agcagcccca gtagcagcag cagcagcccc agcccccgta gcagcagccc cagcagcagc agctccagca ccagcagtcc cagcaccagc agtcccagca gcagcagtcc cagcagcagc agccccagca gcagctgccc cagtgcagcc ctgggcagga ggccacagag cccacagagc tcgcactgtg ccccctttcc ctga. It is sometimes possible for the material contained within the vial of "TPRXL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
