Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TBPL1 cdna clone

TBPL1 cDNA Clone

Gene Names
TBPL1; TLF; TLP; STUD; TRF2; MGC:8389; MGC:9620
Synonyms
TBPL1; TBPL1 cDNA Clone; TBPL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggatgcagacagtgatgttgcattggacattctaattacaaatgtagtctgtgtttttagaacaagatgtcatttaaacttaaggaagattgctttggaaggagcaaatgtaatttataaacgtgatgttggaaaagtattaatgaagcttagaaaacctagaattacagctacaatttggtcctcaggaaaaattatttgcactggagcaacaagtgaagaagaagctaaatttggtgccagacgcttagcccgtagtctgcagaaactaggttttcaggtaatatttacagattttaaggttgttaacgttctggcagtgtgtaacatgccatttgaaatccgtttgccagaattcacaaagaacaatagacctcatgccagttacgaacctgaacttcatcctgctgtgtgctatcggataaaatctctaagagctacattacagattttttcaacaggaagtatcacagtaacagggcccaatgtaaaggctgttgctactgctgtggaacagatttacccatttgtgtttgaaagcaggaaagaaattttataa
Sequence Length
561
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,887 Da
NCBI Official Full Name
Homo sapiens TBP-like 1, mRNA
NCBI Official Synonym Full Names
TATA-box binding protein like 1
NCBI Official Symbol
TBPL1
NCBI Official Synonym Symbols
TLF; TLP; STUD; TRF2; MGC:8389; MGC:9620
NCBI Protein Information
TATA box-binding protein-like protein 1
UniProt Protein Name
TATA box-binding protein-like protein 1
UniProt Gene Name
TBPL1
UniProt Synonym Gene Names
TLF; TLP; TLP21; TRF2; TRP; TBP-like protein 1; STUD; TBP-related factor 2
UniProt Entry Name
TBPL1_HUMAN

NCBI Description

This gene encodes a member of the TATA box-binding protein family. TATA box-binding proteins play a critical role in transcription by RNA polymerase II as components of the transcription factor IID (TFIID) complex. The encoded protein does not bind to the TATA box and initiates transcription from TATA-less promoters. This gene plays a critical role in spermatogenesis, and single nucleotide polymorphisms in this gene may be associated with male infertility. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Nov 2011]

Uniprot Description

TBPL1: Does not bind the TATA box. Has DNA-binding ability. Belongs to the TBP family.

Protein type: DNA-binding; Transcription, coactivator/corepressor; Cell development/differentiation

Chromosomal Location of Human Ortholog: 6q23.2

Molecular Function: protein binding; transcription coactivator activity

Biological Process: transcription from RNA polymerase II promoter

Research Articles on TBPL1

Similar Products

Product Notes

The TBPL1 tbpl1 (Catalog #AAA1278087) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgcag acagtgatgt tgcattggac attctaatta caaatgtagt ctgtgttttt agaacaagat gtcatttaaa cttaaggaag attgctttgg aaggagcaaa tgtaatttat aaacgtgatg ttggaaaagt attaatgaag cttagaaaac ctagaattac agctacaatt tggtcctcag gaaaaattat ttgcactgga gcaacaagtg aagaagaagc taaatttggt gccagacgct tagcccgtag tctgcagaaa ctaggttttc aggtaatatt tacagatttt aaggttgtta acgttctggc agtgtgtaac atgccatttg aaatccgttt gccagaattc acaaagaaca atagacctca tgccagttac gaacctgaac ttcatcctgc tgtgtgctat cggataaaat ctctaagagc tacattacag attttttcaa caggaagtat cacagtaaca gggcccaatg taaaggctgt tgctactgct gtggaacaga tttacccatt tgtgtttgaa agcaggaaag aaattttata a. It is sometimes possible for the material contained within the vial of "TBPL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.