Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TAF1C cdna clone

TAF1C cDNA Clone

Gene Names
TAF1C; SL1; TAFI95; TAFI110; MGC:39976
Synonyms
TAF1C; TAF1C cDNA Clone; TAF1C cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcctcccctcatcgatccctgggaccctggcctgactgcccgggacctgcttttccgcggagggtaccggtatcggaagcggccccgagtcgtgctggatgtgactgagcagatcagccggttcctcttggatcatggagacgtagcctttgcgcccctggggaagctgatgctggagaatttcaagctggagggagcggggagccgcactaagaagaagacagtggtcagtgtgaagaagctgctccaggacctcggtggacaccagccctgggggtgtccctgggcttacctcagcaaccgacagcgccgcttctctatcctcgggggccccatcctgggcacgtcggtggcgagccacttggcagagctgctgcacgaggagctggtgctgcggtgggagcagctgcttctggatgaggcctgcactgggggcgcgctggcctgggttcctggaaggacaccccagttcgggcagctggtctaccctgctggaggcgcccaggacaggctgcatttccaagaggtcgttctgaccccaggtgacaatccccaattccttgggaaacctggacgcatccagctccagggacctgtccggcaagtggtgacatgcaccgtccagggagaaactctgctggccgtccgctctgactaccactgtgccgtgtggaagtttggtaaacagtggcagccaacccttctgcaggcgatgcaggtggagaaaggggccacggggatcagcctcagccctcacctgcccggggagctggccatctgcagccgctcgggagccgtctgcctgtggagccctgaggatgggctgcggcaaatctacagggaccctgagaccctcgtgttccgggactcctcttcgtggcgttgggcagacttcactgcgcaccctcgggtgctgaccgtgggtgaccgcaccggagtgaagatgctggacactcagggcccgccgggctgtggtctgttgctttttcgtttgggggcagaggcttcgtgccagaaaggggaacgtgtcctgcttacccagtacctggggcactccagccccaaatgcctcccccctactcttcatctcgtctgtacccagttctctctctacctagtggacgagcgccttcccctggtgccgatgctgaagtggaaccatggcctcccctccccgctcctgctggcccgactgctgcctccgccccggcccagctgcgtgcagcccctgctcctcggaggccagggtgggcagctgcagctgctgcacctggcagaaggggcgtcggtgccccgcctggcaggccccccccagtctcttccttccaggatcgactccctccctgcatttcctctgctggagcctaagatccagtggcggctgcaggagcgcctgaaagcaccgaccataggtctggctgccgtcgtcccgcccatgccctcagcgcccacaccaggcctggtgctcttccagctctcggcggcgggagatgtcttctaccagcagctccgcccccaggtggactccagcctccgcagagatgctgggcctcctggcgacacccaacctgactgccatgcccccacagcttcctggacctcccaggacactgccggctgcagccagtggctgaaggccctgctaaaagtgcccctggctcctcctgtgtggacagcacccaccttcacccaccgccagatgctgggcagcacagagctgcggagggaggaagaggaagggcagcggctgggtgtactccgcaaggccatggcccgagggcagctcctgctgcagagagacctgggctccctccctgcggcagagccaccccctgcacccgagtcaggcctagaggacaagctcagtgagcgcctgggggaagcctgggcaggccgaggggctgcctggtgggagaggcagcagggcaggacctcggagcccgggagacagaccaggcggcccaagcgccggacccagctgtccagcagcttttcgctcagtggccatgtggatccctcagaggacaccagctcccctcatagccctgagtggccacctgctgatgctctgcccctgccccccacgaccccgccctcccaggagttgactccggatgcatgcgcccagggcgtcccatcagagcagcggcagatgctccgtgactacatggccaagctaccaccccagagggacaccccaggctgtgccaccacacctccccactcccaggcctccagcgtccgggccactcgctcccagcagcacacacccgtcctctctagctctcagcccctccgtaagaagcctcgaatgggcttctga
Sequence Length
2328
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
92,284 Da
NCBI Official Full Name
Homo sapiens TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa, mRNA
NCBI Official Synonym Full Names
TATA-box binding protein associated factor, RNA polymerase I subunit C
NCBI Official Symbol
TAF1C
NCBI Official Synonym Symbols
SL1; TAFI95; TAFI110; MGC:39976
NCBI Protein Information
TATA box-binding protein-associated factor RNA polymerase I subunit C
UniProt Protein Name
TATA box-binding protein-associated factor RNA polymerase I subunit C
UniProt Gene Name
TAF1C
UniProt Synonym Gene Names
TAFI110; TBP-associated factor 1C
UniProt Entry Name
TAF1C_HUMAN

NCBI Description

Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]

Uniprot Description

TAF1C: Component of the transcription factor SL1/TIF-IB complex, which is involved in the assembly of the PIC (preinitiation complex) during RNA polymerase I-dependent transcription. The rate of PIC formation probably is primarily dependent on the rate of association of SL1/TIF-IB with the rDNA promoter. SL1/TIF-IB is involved in stabilization of nucleolar transcription factor 1/UBTF on rDNA. Formation of SL1/TIF-IB excludes the association of TBP with TFIID subunits. Recruits RNA polymerase I to the rRNA gene promoter via interaction with RRN3. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription initiation complex

Chromosomal Location of Human Ortholog: 16q24

Cellular Component: intracellular membrane-bound organelle; nucleoplasm; RNA polymerase I transcription factor complex

Molecular Function: protein binding

Biological Process: positive regulation of gene expression, epigenetic; RNA elongation from RNA polymerase I promoter; termination of RNA polymerase I transcription; transcription from RNA polymerase I promoter; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase I promoter

Research Articles on TAF1C

Similar Products

Product Notes

The TAF1C taf1c (Catalog #AAA1273446) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcctc ccctcatcga tccctgggac cctggcctga ctgcccggga cctgcttttc cgcggagggt accggtatcg gaagcggccc cgagtcgtgc tggatgtgac tgagcagatc agccggttcc tcttggatca tggagacgta gcctttgcgc ccctggggaa gctgatgctg gagaatttca agctggaggg agcggggagc cgcactaaga agaagacagt ggtcagtgtg aagaagctgc tccaggacct cggtggacac cagccctggg ggtgtccctg ggcttacctc agcaaccgac agcgccgctt ctctatcctc gggggcccca tcctgggcac gtcggtggcg agccacttgg cagagctgct gcacgaggag ctggtgctgc ggtgggagca gctgcttctg gatgaggcct gcactggggg cgcgctggcc tgggttcctg gaaggacacc ccagttcggg cagctggtct accctgctgg aggcgcccag gacaggctgc atttccaaga ggtcgttctg accccaggtg acaatcccca attccttggg aaacctggac gcatccagct ccagggacct gtccggcaag tggtgacatg caccgtccag ggagaaactc tgctggccgt ccgctctgac taccactgtg ccgtgtggaa gtttggtaaa cagtggcagc caacccttct gcaggcgatg caggtggaga aaggggccac ggggatcagc ctcagccctc acctgcccgg ggagctggcc atctgcagcc gctcgggagc cgtctgcctg tggagccctg aggatgggct gcggcaaatc tacagggacc ctgagaccct cgtgttccgg gactcctctt cgtggcgttg ggcagacttc actgcgcacc ctcgggtgct gaccgtgggt gaccgcaccg gagtgaagat gctggacact cagggcccgc cgggctgtgg tctgttgctt tttcgtttgg gggcagaggc ttcgtgccag aaaggggaac gtgtcctgct tacccagtac ctggggcact ccagccccaa atgcctcccc cctactcttc atctcgtctg tacccagttc tctctctacc tagtggacga gcgccttccc ctggtgccga tgctgaagtg gaaccatggc ctcccctccc cgctcctgct ggcccgactg ctgcctccgc cccggcccag ctgcgtgcag cccctgctcc tcggaggcca gggtgggcag ctgcagctgc tgcacctggc agaaggggcg tcggtgcccc gcctggcagg ccccccccag tctcttcctt ccaggatcga ctccctccct gcatttcctc tgctggagcc taagatccag tggcggctgc aggagcgcct gaaagcaccg accataggtc tggctgccgt cgtcccgccc atgccctcag cgcccacacc aggcctggtg ctcttccagc tctcggcggc gggagatgtc ttctaccagc agctccgccc ccaggtggac tccagcctcc gcagagatgc tgggcctcct ggcgacaccc aacctgactg ccatgccccc acagcttcct ggacctccca ggacactgcc ggctgcagcc agtggctgaa ggccctgcta aaagtgcccc tggctcctcc tgtgtggaca gcacccacct tcacccaccg ccagatgctg ggcagcacag agctgcggag ggaggaagag gaagggcagc ggctgggtgt actccgcaag gccatggccc gagggcagct cctgctgcag agagacctgg gctccctccc tgcggcagag ccaccccctg cacccgagtc aggcctagag gacaagctca gtgagcgcct gggggaagcc tgggcaggcc gaggggctgc ctggtgggag aggcagcagg gcaggacctc ggagcccggg agacagacca ggcggcccaa gcgccggacc cagctgtcca gcagcttttc gctcagtggc catgtggatc cctcagagga caccagctcc cctcatagcc ctgagtggcc acctgctgat gctctgcccc tgccccccac gaccccgccc tcccaggagt tgactccgga tgcatgcgcc cagggcgtcc catcagagca gcggcagatg ctccgtgact acatggccaa gctaccaccc cagagggaca ccccaggctg tgccaccaca cctccccact cccaggcctc cagcgtccgg gccactcgct cccagcagca cacacccgtc ctctctagct ctcagcccct ccgtaagaag cctcgaatgg gcttctga. It is sometimes possible for the material contained within the vial of "TAF1C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.