Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

TAF1A cdna clone

TAF1A cDNA Clone

Gene Names
TAF1A; SL1; RAFI48; TAFI48; MGC:17061
Synonyms
TAF1A; TAF1A cDNA Clone; TAF1A cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgagtgatttcagtgaagaattaaaagggcctgtgacagatgatgaagaagtggaaacatctgtgctcagtggtgcaggaatgcattttccttggcttcaaacatacgtagaaactgtggccattggagggaaaaggaggaaggattttgctcagacaacaagtgcttgtttaagttttatccaagaagctctgctgaagcaccaatggcagcaagctgcagaatacatgtacagttattttcagaccttggaagattcagatagctacaaaaggcaggctgcacctgagattatttggaagctcggaagtgaaattctattttatcatcccaaaagcaacatggagagtttcaatacttttgctaaccggatgaaaaatattggcgtcatgaattatttaaagatctccttacaacatgcattataccttctgcatcatggaatgcttaaagatgctaagagaaatctgagtgaggcagagacatggagacatggtgaaaatacgtcttcccgggaaatattaatcaaccttattcaggcctataaagggcttttacagtattatacctggtctgaaaagaagatggaattgtcaaagcttgataaggatgattatgcttacaatgcagtagcccaggatgtgttcaaccacagctggaagacatctgcaaatatttctgcattgattaaaattcctggagtttgggacccttttgtgaagagttatgtagaaatgctggaattctatggggatcgagatggagcccaagaggtactcaccaattatgcatatgatgaaaagtttccatcaaatccaaatgcccatatctacttatacaactttctaaagagacagaaggcaccaagatcaaaattgataagtgtgcttaagattttgtatcagattgtaccatctcataaattgatgttggaattccatacattacttagaaaatcagaaaaagaagaacaccgtaaactggggttggaggtattatttggagtcttagattttgccggatgcactaagaatataactgcttggaaatacttggcaaaatatctgaaaaatatcttaatgggaaaccaccttgcgtgggttcaagaagagtggaactccaggaaaaactggtggccagggtttcatttcagctacttttgggcaaaaagtgattggaaggaagatacagctttggcctgtgagaaagcttttgtggctggtttactgttaggaaaaggttgtagatatttccggtatattttaaagcaagatcaccaaatcttagggaagaaaattaagcggatgaagagatctgtgaaaaaatacagtattgtaaatccaagactctga
Sequence Length
1353
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,615 Da
NCBI Official Full Name
Homo sapiens TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa, mRNA
NCBI Official Synonym Full Names
TATA-box binding protein associated factor, RNA polymerase I subunit A
NCBI Official Symbol
TAF1A
NCBI Official Synonym Symbols
SL1; RAFI48; TAFI48; MGC:17061
NCBI Protein Information
TATA box-binding protein-associated factor RNA polymerase I subunit A
UniProt Protein Name
TATA box-binding protein-associated factor RNA polymerase I subunit A
UniProt Gene Name
TAF1A
UniProt Synonym Gene Names
TAFI48; TBP-associated factor 1A
UniProt Entry Name
TAF1A_HUMAN

NCBI Description

This gene encodes a subunit of the RNA polymerase I complex, Selectivity Factor I (SLI). The encoded protein is a TATA box-binding protein-associated factor that plays a role in the assembly of the RNA polymerase I preinitiation complex. Alternate splicing results in multiple transcript variants encoding multiple isoforms.[provided by RefSeq, Jan 2011]

Uniprot Description

TAF1A: Component of the transcription factor SL1/TIF-IB complex, which is involved in the assembly of the PIC (preinitiation complex) during RNA polymerase I-dependent transcription. The rate of PIC formation probably is primarily dependent on the rate of association of SL1/TIF-IB with the rDNA promoter. SL1/TIF-IB is involved in stabilization of nucleolar transcription factor 1/UBTF on rDNA. Formation of SL1/TIF-IB excludes the association of TBP with TFIID subunits. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1q42

Cellular Component: intracellular membrane-bound organelle; microtubule cytoskeleton; nucleoplasm; nucleus; RNA polymerase I transcription factor complex

Molecular Function: protein binding

Biological Process: positive regulation of gene expression, epigenetic; RNA elongation from RNA polymerase I promoter; termination of RNA polymerase I transcription; transcription from RNA polymerase I promoter; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase I promoter

Research Articles on TAF1A

Similar Products

Product Notes

The TAF1A taf1a (Catalog #AAA1271527) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgatt tcagtgaaga attaaaaggg cctgtgacag atgatgaaga agtggaaaca tctgtgctca gtggtgcagg aatgcatttt ccttggcttc aaacatacgt agaaactgtg gccattggag ggaaaaggag gaaggatttt gctcagacaa caagtgcttg tttaagtttt atccaagaag ctctgctgaa gcaccaatgg cagcaagctg cagaatacat gtacagttat tttcagacct tggaagattc agatagctac aaaaggcagg ctgcacctga gattatttgg aagctcggaa gtgaaattct attttatcat cccaaaagca acatggagag tttcaatact tttgctaacc ggatgaaaaa tattggcgtc atgaattatt taaagatctc cttacaacat gcattatacc ttctgcatca tggaatgctt aaagatgcta agagaaatct gagtgaggca gagacatgga gacatggtga aaatacgtct tcccgggaaa tattaatcaa ccttattcag gcctataaag ggcttttaca gtattatacc tggtctgaaa agaagatgga attgtcaaag cttgataagg atgattatgc ttacaatgca gtagcccagg atgtgttcaa ccacagctgg aagacatctg caaatatttc tgcattgatt aaaattcctg gagtttggga cccttttgtg aagagttatg tagaaatgct ggaattctat ggggatcgag atggagccca agaggtactc accaattatg catatgatga aaagtttcca tcaaatccaa atgcccatat ctacttatac aactttctaa agagacagaa ggcaccaaga tcaaaattga taagtgtgct taagattttg tatcagattg taccatctca taaattgatg ttggaattcc atacattact tagaaaatca gaaaaagaag aacaccgtaa actggggttg gaggtattat ttggagtctt agattttgcc ggatgcacta agaatataac tgcttggaaa tacttggcaa aatatctgaa aaatatctta atgggaaacc accttgcgtg ggttcaagaa gagtggaact ccaggaaaaa ctggtggcca gggtttcatt tcagctactt ttgggcaaaa agtgattgga aggaagatac agctttggcc tgtgagaaag cttttgtggc tggtttactg ttaggaaaag gttgtagata tttccggtat attttaaagc aagatcacca aatcttaggg aagaaaatta agcggatgaa gagatctgtg aaaaaataca gtattgtaaa tccaagactc tga. It is sometimes possible for the material contained within the vial of "TAF1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual