Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNRPD1 cdna clone

SNRPD1

Gene Names
SNRPD1; SMD1; SNRPD; Sm-D1; HsT2456
Synonyms
SNRPD1; HsT2456; Sm-D1; SMD1; SNRPD; SNRPD1 cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGAAGCTCGTGAGATTTTTGATGAAATTGAGTCATGAAACTGTAACCATTGAATTGAAGAACGGAACACAGGTCCATGGAACAATCACAGGTGTGGATGTCAGCATGAATACACATCTTAAAGCTGTGAAAATGACCCTGAAGAACAGAGAACCTGTACAGCTGGAAACGCTGAGTATTCGAGGAAATAACATTCGGTATTTTATTCTACCAGACAGTTTACCTCTGGATACACTACTTGTGGATGTTGAACCTAAGGTGAAATCTAAGAAAAGGGAAGCTGTTGCAGGAAGAGGCAGAGGAAGAGGAAGAGGAAGAGGACGTGGCCGTGGCAGAGGAAGAGGGGGTCCTAGGCGATAA

Translation Sequence: MKLVRFLMKL SHETVTIELK NGTQVHGTIT GVDVSMNTHL KAVKMTLKNR EPVQLETLSIRGNNIRYFIL PDSLPLDTLL VDVEPKVKSK KREAVAGRGR GRGRGRGRGR GRGRGGPRR
Sequence Length
119
Species
Human
Chromosome Location
18q11.2
OMIM Reference Number
601063
cDNA Size
360bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for SNRPD1 cdna clone
SNRPD1 encodes a small nuclear ribonucleoprotein that belongs to the SNRNP core protein family. SNRPD1 may act as a charged protein scaffold to promote SNRNP assembly or strengthen SNRNP-SNRNP interactions through nonspecific electrostatic contacts with RNA. Two transcript variants encoding different isoforms have been found for this gene.
Product Categories/Family for SNRPD1 cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
small nuclear ribonucleoprotein Sm D1 isoform 1
NCBI Official Synonym Full Names
small nuclear ribonucleoprotein D1 polypeptide
NCBI Official Symbol
SNRPD1
NCBI Official Synonym Symbols
SMD1; SNRPD; Sm-D1; HsT2456
NCBI Protein Information
small nuclear ribonucleoprotein Sm D1
UniProt Protein Name
Small nuclear ribonucleoprotein Sm D1
UniProt Gene Name
SNRPD1
UniProt Synonym Gene Names
Sm-D1
UniProt Entry Name
SMD1_HUMAN

NCBI Description

This gene encodes a small nuclear ribonucleoprotein that belongs to the SNRNP core protein family. The protein may act as a charged protein scaffold to promote SNRNP assembly or strengthen SNRNP-SNRNP interactions through nonspecific electrostatic contacts with RNA. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]

Uniprot Description

snRNP D1: May act as a charged protein scaffold to promote snRNP assembly or strengthen snRNP-snRNP interactions through nonspecific electrostatic contacts with RNA. Belongs to the snRNP core protein family.

Protein type: Spliceosome; RNA splicing; RNA-binding

Chromosomal Location of Human Ortholog: 18q11.2

Cellular Component: small nuclear ribonucleoprotein complex; nucleoplasm; snRNP U1; cytosol; nucleus; U12-dependent spliceosome

Molecular Function: protein binding; RNA binding

Biological Process: nuclear mRNA splicing, via spliceosome; spliceosomal snRNP biogenesis; RNA splicing; spliceosome assembly; gene expression

Research Articles on SNRPD1

Similar Products

Product Notes

The SNRPD1 snrpd1 (Catalog #AAA200763) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGAAGCTCG TGAGATTTTT GATGAAATTG AGTCATGAAA CTGTAACCAT TGAATTGAAG AACGGAACAC AGGTCCATGG AACAATCACA GGTGTGGATG TCAGCATGAA TACACATCTT AAAGCTGTGA AAATGACCCT GAAGAACAGA GAACCTGTAC AGCTGGAAAC GCTGAGTATT CGAGGAAATA ACATTCGGTA TTTTATTCTA CCAGACAGTT TACCTCTGGA TACACTACTT GTGGATGTTG AACCTAAGGT GAAATCTAAG AAAAGGGAAG CTGTTGCAGG AAGAGGCAGA GGAAGAGGAA GAGGAAGAGG ACGTGGCCGT GGCAGAGGAA GAGGGGGTCC TAGGCGATAA Tr anslation Sequence: MKLVRFLMKL SHETVTIELK NGTQVHGTIT GVDVSMNTHL KAVKMTLKNR EPVQLETLSI RGNNIRYFIL PDSLPLDTLL VDVEPKVKSK KREAVAGRGR GRGRGRGRGR GRGRGGPRR. It is sometimes possible for the material contained within the vial of "SNRPD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.