Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMEK1 cdna clone

SMEK1 cDNA Clone

Gene Names
PPP4R3A; smk1; FLFL1; PP4R3; SMEK1; smk-1; PP4R3A; MSTP033; KIAA2010
Synonyms
SMEK1; SMEK1 cDNA Clone; SMEK1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccgacacccggcggcgggtgaaggtgtacacgctcaacgaggaccggcagtgggacgaccggggcaccgggcatgtgtcgtctggctacgtggagcggctgaagggcatgtccctgcttgtcagggctgagagcgacggttctctacttttagagtcgaaaataaatcctaacactgcataccagaaacaacaggaagatgaaaaatttctgacagatttgtttgcacaactaacagatgaagcaacagatgaggaaaaaagacaggaattggttaactttttaaaagaattttgtgcgttttcccaaacgctacagcctcaaaacagagatgcttttttcaagactttgtcaaacatgggcatattaccagctttagaagtcatccttggcatggatgatacacaggtgcgaagtgctgctactgatatattctcatacttggttgaatataatccatccatggtacgagagtttgtcatgcaggaggcacaacagaatgatgatgtaagtaagaagttaacagagcaaaaaataaccagcaaggatattttgctcatcaacctcattatagaacatatgatttgtgatacagatcctgaacttggaggagcagtccagcttatgggcctgcttcgaactttagttgacccagagaacatgctagccactgccaataaaacagaaaagactgaatttctgggtttcttctacaagcactgtatgcatgttctcactgctcctttactagcaaatacaacagaagacaaacctagtaaagatgattttcagactgcccaactattggcacttgtattggaattgttaacattttgtgtggagcaccatacctaccacataaagaactacattattaataaggatatcctccggagagtgctagttcttatggcctcgaagcatgctttcttggcattatgtgcccttcgttttaaaagaaagattattggattaaaagatgagttttacaaccgctacataatgaaaagttttttgtttgaaccagtagtgaaagcatttctcaacaatggatcccgctacaatctgatgaactctgccataatagagatgtttgaatttattagagtggaagatataaaatcattaactgctcatgtaattgaaaattactggaaagcactggaagatgtagattatgtacagacatttaaaggattaaaactgagatttgaacaacaaagagaaaggcaagataatcccaaacttgacagtatgcgttccattttgaggaatcacagatatcgaagagatgccagaacactagaagatgaagaagagatgtggtttaacacagatgaagatgacatggaagatggagaagctgtagtgtctccatctgacaaaactaaaaatgatgatgatattatggatccaataagtaaattcatggaaaggaagaaattaaaagaaagtgaggaaaaggaagtgcttctgaaaacaaacctttctggacggcagagcccaagtttcaagctttccctgtccagtggaacgaagactaacctcaccagccagtcatctacaacaaatctgcctggttctccgggatcacctggatccccaggatctccaggctctcctggatccgtacctaaaaatacatctcagacggcagctattactacaaagggaggcctcgtgggtctggtagattatcctgatgatgatgaagatgatgatgaggatgaagataaggaagatacgttaccattgtcaaagaaagcaaaatttgattcataa
Sequence Length
1785
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,020 Da
NCBI Official Full Name
Homo sapiens SMEK homolog 1, suppressor of mek1 (Dictyostelium), mRNA
NCBI Official Synonym Full Names
protein phosphatase 4 regulatory subunit 3A
NCBI Official Symbol
PPP4R3A
NCBI Official Synonym Symbols
smk1; FLFL1; PP4R3; SMEK1; smk-1; PP4R3A; MSTP033; KIAA2010
NCBI Protein Information
serine/threonine-protein phosphatase 4 regulatory subunit 3A
UniProt Protein Name
Serine/threonine-protein phosphatase 4 regulatory subunit 3A
UniProt Gene Name
PPP4R3A
UniProt Entry Name
P4R3A_HUMAN

Uniprot Description

SMEK1: a conserved single-pass membrane protein. In Dictyostelium, the SMEK homolog regulates myosin II assembly and cytokinesis during vegetative growth. Loss of SMEK suppresses defects in cell polarity, chemotaxis, and gene expression in MEK1 null cells. Six alternatively-spliced isoforms have been described.

Protein type: Membrane protein, integral; Protein phosphatase, regulatory subunit; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 14q32.12

Research Articles on SMEK1

Similar Products

Product Notes

The SMEK1 ppp4r3a (Catalog #AAA1270181) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgaca cccggcggcg ggtgaaggtg tacacgctca acgaggaccg gcagtgggac gaccggggca ccgggcatgt gtcgtctggc tacgtggagc ggctgaaggg catgtccctg cttgtcaggg ctgagagcga cggttctcta cttttagagt cgaaaataaa tcctaacact gcataccaga aacaacagga agatgaaaaa tttctgacag atttgtttgc acaactaaca gatgaagcaa cagatgagga aaaaagacag gaattggtta actttttaaa agaattttgt gcgttttccc aaacgctaca gcctcaaaac agagatgctt ttttcaagac tttgtcaaac atgggcatat taccagcttt agaagtcatc cttggcatgg atgatacaca ggtgcgaagt gctgctactg atatattctc atacttggtt gaatataatc catccatggt acgagagttt gtcatgcagg aggcacaaca gaatgatgat gtaagtaaga agttaacaga gcaaaaaata accagcaagg atattttgct catcaacctc attatagaac atatgatttg tgatacagat cctgaacttg gaggagcagt ccagcttatg ggcctgcttc gaactttagt tgacccagag aacatgctag ccactgccaa taaaacagaa aagactgaat ttctgggttt cttctacaag cactgtatgc atgttctcac tgctccttta ctagcaaata caacagaaga caaacctagt aaagatgatt ttcagactgc ccaactattg gcacttgtat tggaattgtt aacattttgt gtggagcacc atacctacca cataaagaac tacattatta ataaggatat cctccggaga gtgctagttc ttatggcctc gaagcatgct ttcttggcat tatgtgccct tcgttttaaa agaaagatta ttggattaaa agatgagttt tacaaccgct acataatgaa aagttttttg tttgaaccag tagtgaaagc atttctcaac aatggatccc gctacaatct gatgaactct gccataatag agatgtttga atttattaga gtggaagata taaaatcatt aactgctcat gtaattgaaa attactggaa agcactggaa gatgtagatt atgtacagac atttaaagga ttaaaactga gatttgaaca acaaagagaa aggcaagata atcccaaact tgacagtatg cgttccattt tgaggaatca cagatatcga agagatgcca gaacactaga agatgaagaa gagatgtggt ttaacacaga tgaagatgac atggaagatg gagaagctgt agtgtctcca tctgacaaaa ctaaaaatga tgatgatatt atggatccaa taagtaaatt catggaaagg aagaaattaa aagaaagtga ggaaaaggaa gtgcttctga aaacaaacct ttctggacgg cagagcccaa gtttcaagct ttccctgtcc agtggaacga agactaacct caccagccag tcatctacaa caaatctgcc tggttctccg ggatcacctg gatccccagg atctccaggc tctcctggat ccgtacctaa aaatacatct cagacggcag ctattactac aaagggaggc ctcgtgggtc tggtagatta tcctgatgat gatgaagatg atgatgagga tgaagataag gaagatacgt taccattgtc aaagaaagca aaatttgatt cataa. It is sometimes possible for the material contained within the vial of "SMEK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.