Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SHOC2 cdna clone

SHOC2 cDNA Clone

Gene Names
SHOC2; SOC2; SUR8; SIAA0862
Synonyms
SHOC2; SHOC2 cDNA Clone; SHOC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtagtagtttaggaaaagaaaaagactctaaagaaaaagatcccaaagtaccatcagccaaggaaagagaaaaggaggcaaaagcctctggaggttttgggaaagagagcaaagaaaaagaacctaagaccaaagggaaagatgccaaagatggaaagaaggactccagtgctgcccaaccaggggtggcattttcagttgacaatacgatcaaacggccaaacccagcacctgggactagaaaaaaatccagcaatgcagaggtgattaaagagctcaacaaatgccgggaagagaattcaatgcgtttggacttatccaagagatctatacacatattgccatcatcaatcaaagagttgactcaattaacagaactttatttatacagtaacaaattgcagtccctcccagcagaggtgggatgtttagtaaatctcatgacactggctctaagtgaaaattcacttaccagtttgcctgactctcttgataacttgaagaagctgcggatgcttgatttacggcataataaactgagagaaattccttcagtggtgtataggctggattctctcaccactctttaccttcgctttaatcgtataactactgtggaaaaggacatcaaaaacttgtcaaaactcagcatgcttagcattcgagagaacaaaattaaacaactacctgctgaaattggtgaattatgtaacctcattacgctggatgtagctcacaatcaacttgaacaccttccaaaggagattggaaactgtacacagataaccaaccttgacttgcagcacaatgaactgctagacctcccagatactataggaaacctgtccagtttaagtcgtcttggtctgagatataacagactgtcagcaatacccagatcattagcaaaatgcagtgcacttgaagaattaaatttagagaacaataacatttctactttaccagagagtcttttatcaagtcttgtgaaactgaatagtttgaccttagctagaaattgcttccagttgtatccagtgggtggtccatctcagttttctaccatctattccctcaacatggaacacaatcgaatcaacaaaattccatttggaattttctccagagcaaaagtattaagtaagctgaatatgaaggacaatcagttaacatcacttcccttggattttggaacttggaccagtatggtagaattgaatttagccactaatcagctcacaaagatccctgaggatgtgtctggtctcgtttctcttgaggttcttatcttatcaaacaatcttctaaagaagcttccccatggtcttggaaaccttaggaagttaagagagttggatctagaagagaacaaattggaatccttgccaaatgaaattgcatatcttaaggatttacagaaattagtcttgacaaacaaccagttgaccactcttcccagaggcattggtcaccttactaatctcacacatctgggccttggagagaacctacttactcaccttcctgaagaaattggtacactggagaacctagaagaactgtatttgaatgacaaccccaacctgcatagccttccctttgagctggcactctgcagcaagctttcaatcatgagtattgagaactgtccactcagtcaccttccacctcagattgttgctggggggccttctttcatcattcagttcttaaagatgcagggtccatatcgtgccatggtctga
Sequence Length
1749
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,743 Da
NCBI Official Full Name
Homo sapiens soc-2 suppressor of clear homolog (C. elegans), mRNA
NCBI Official Synonym Full Names
SHOC2, leucine rich repeat scaffold protein
NCBI Official Symbol
SHOC2
NCBI Official Synonym Symbols
SOC2; SUR8; SIAA0862
NCBI Protein Information
leucine-rich repeat protein SHOC-2
UniProt Protein Name
Leucine-rich repeat protein SHOC-2
UniProt Gene Name
SHOC2
UniProt Synonym Gene Names
KIAA0862
UniProt Entry Name
SHOC2_HUMAN

NCBI Description

This gene encodes a protein that consists almost entirely of leucine-rich repeats, a domain implicated in protein-protein interactions. The protein may function as a scaffold linking RAS to downstream signal transducers in the RAS/ERK MAP kinase signaling cascade. Mutations in this gene have been associated with Noonan-like syndrome with loose anagen hair. [provided by RefSeq, May 2010]

Uniprot Description

SHOC2: Regulatory subunit of protein phosphatase 1 (PP1c) that acts as a M-Ras/MRAS effector and participates in MAPK pathway activation. Upon M-Ras/MRAS activation, targets PP1c to specifically dephosphorylate the 'Ser-259' inhibitory site of RAF1 kinase and stimulate RAF1 activity at specialized signaling complexes. Defects in SHOC2 are the cause of Noonan syndrome-like disorder with loose anagen hair (NSLH). A syndrome characterized by Noonan dysmorphic features such as macrocephaly, high forehead, hypertelorism, palpebral ptosis, low-set and posteriorly rotated ears, short and webbed neck, pectus anomalies, in association with pluckable, sparse, thin and slow-growing hair. Belongs to the SHOC2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 10q25

Cellular Component: cytoplasm; nucleoplasm; nucleus; protein phosphatase type 1 complex

Molecular Function: protein binding; protein phosphatase 1 binding; protein phosphatase binding; protein phosphatase regulator activity

Biological Process: positive regulation of Ras protein signal transduction

Disease: Noonan Syndrome-like Disorder With Loose Anagen Hair

Research Articles on SHOC2

Similar Products

Product Notes

The SHOC2 shoc2 (Catalog #AAA1271490) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtagta gtttaggaaa agaaaaagac tctaaagaaa aagatcccaa agtaccatca gccaaggaaa gagaaaagga ggcaaaagcc tctggaggtt ttgggaaaga gagcaaagaa aaagaaccta agaccaaagg gaaagatgcc aaagatggaa agaaggactc cagtgctgcc caaccagggg tggcattttc agttgacaat acgatcaaac ggccaaaccc agcacctggg actagaaaaa aatccagcaa tgcagaggtg attaaagagc tcaacaaatg ccgggaagag aattcaatgc gtttggactt atccaagaga tctatacaca tattgccatc atcaatcaaa gagttgactc aattaacaga actttattta tacagtaaca aattgcagtc cctcccagca gaggtgggat gtttagtaaa tctcatgaca ctggctctaa gtgaaaattc acttaccagt ttgcctgact ctcttgataa cttgaagaag ctgcggatgc ttgatttacg gcataataaa ctgagagaaa ttccttcagt ggtgtatagg ctggattctc tcaccactct ttaccttcgc tttaatcgta taactactgt ggaaaaggac atcaaaaact tgtcaaaact cagcatgctt agcattcgag agaacaaaat taaacaacta cctgctgaaa ttggtgaatt atgtaacctc attacgctgg atgtagctca caatcaactt gaacaccttc caaaggagat tggaaactgt acacagataa ccaaccttga cttgcagcac aatgaactgc tagacctccc agatactata ggaaacctgt ccagtttaag tcgtcttggt ctgagatata acagactgtc agcaataccc agatcattag caaaatgcag tgcacttgaa gaattaaatt tagagaacaa taacatttct actttaccag agagtctttt atcaagtctt gtgaaactga atagtttgac cttagctaga aattgcttcc agttgtatcc agtgggtggt ccatctcagt tttctaccat ctattccctc aacatggaac acaatcgaat caacaaaatt ccatttggaa ttttctccag agcaaaagta ttaagtaagc tgaatatgaa ggacaatcag ttaacatcac ttcccttgga ttttggaact tggaccagta tggtagaatt gaatttagcc actaatcagc tcacaaagat ccctgaggat gtgtctggtc tcgtttctct tgaggttctt atcttatcaa acaatcttct aaagaagctt ccccatggtc ttggaaacct taggaagtta agagagttgg atctagaaga gaacaaattg gaatccttgc caaatgaaat tgcatatctt aaggatttac agaaattagt cttgacaaac aaccagttga ccactcttcc cagaggcatt ggtcacctta ctaatctcac acatctgggc cttggagaga acctacttac tcaccttcct gaagaaattg gtacactgga gaacctagaa gaactgtatt tgaatgacaa ccccaacctg catagccttc cctttgagct ggcactctgc agcaagcttt caatcatgag tattgagaac tgtccactca gtcaccttcc acctcagatt gttgctgggg ggccttcttt catcattcag ttcttaaaga tgcagggtcc atatcgtgcc atggtctga. It is sometimes possible for the material contained within the vial of "SHOC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.