Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINB2 cdna clone

SERPINB2 cDNA Clone

Gene Names
SERPINB2; PAI; PAI2; PAI-2; PLANH2; HsT1201
Synonyms
SERPINB2; SERPINB2 cDNA Clone; SERPINB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggatctttgtgtggcaaacacactctttgccctcaatttattcaagcatctggcaaaagcaagccccacccagaacctcttcctctccccatggagcatctcgtccaccatggccatggtctacatgggctccaggggcagcaccgaagaccagatggccaaggtgcttcagtttaatgaagtgggagccaatgcagttacccccatgactccagagaactttaccagctgtgggttcatgcagcagatccagaagggtagttatcctgatgcgattttgcaggcacaagctgcagataaaatccattcatccttccgctctctcagctctgcaatcaatgcatccacagggaattatttactggaaagtgtcaataagctgtttggtgagaagtctgcgagcttccgggaagaatatattcgactctgtcagaaatattactcctcagaaccccaggcagtagacttcctagaatgtgcagaagaagctagaaaaaagatttattcctgggtcaagactcaaaccaaaggcaaaatcccaaacttgttacctgaaggttctgtagatggggataccaggatggtcctggtgaatgctgtctacttcaaaggaaagtggaaaactccatttgagaagaaactaaatgggctttatcctttccgtgtaaactcggctcagcgcacacctgtacagatgatgtacttgcgtgaaaagctaaacattggatacatagaagacctaaaggctcagattctagaactcccatatgctggagatgttagcatgttcttgttgcttccagatgaaattgccgatgtgtccactggcttggagctgctggaaagtgaaataacctatgacaaactcaacaagtggaccagcaaagacaaaatggctgaagatgaagttgaggtatacataccccagttcaaattagaagagcattatgaactcagatccattctgagaagcatgggcatggaggacgccttcaacaagggacgggccaatttctcagggatgtcggagaggaatgacctgtttctttctgaagtgttccaccaagccatggtggatgtgaatgaggagggcactgaagcagccgctggcacaggaggtgttatgacagggagaactggacatggaggcccacagtttgtggcagatcatccttttctttttcttattatgcataagataaccaactgcattttatttttcggcagattttcctcaccctaa
Sequence Length
1248
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,596 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 2, mRNA
NCBI Official Synonym Full Names
serpin family B member 2
NCBI Official Symbol
SERPINB2
NCBI Official Synonym Symbols
PAI; PAI2; PAI-2; PLANH2; HsT1201
NCBI Protein Information
plasminogen activator inhibitor 2
UniProt Protein Name
Plasminogen activator inhibitor 2
UniProt Gene Name
SERPINB2
UniProt Synonym Gene Names
PAI2; PLANH2; PAI-2
UniProt Entry Name
PAI2_HUMAN

Uniprot Description

SERPINB2: Inhibits urokinase-type plasminogen activator. The monocyte derived PAI-2 is distinct from the endothelial cell- derived PAI-1. Belongs to the serpin family. Ov-serpin subfamily.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 18q21.3

Cellular Component: cytoplasm; extracellular region; extracellular space; plasma membrane

Molecular Function: serine-type endopeptidase inhibitor activity

Biological Process: fibrinolysis

Research Articles on SERPINB2

Similar Products

Product Notes

The SERPINB2 serpinb2 (Catalog #AAA1278160) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggatc tttgtgtggc aaacacactc tttgccctca atttattcaa gcatctggca aaagcaagcc ccacccagaa cctcttcctc tccccatgga gcatctcgtc caccatggcc atggtctaca tgggctccag gggcagcacc gaagaccaga tggccaaggt gcttcagttt aatgaagtgg gagccaatgc agttaccccc atgactccag agaactttac cagctgtggg ttcatgcagc agatccagaa gggtagttat cctgatgcga ttttgcaggc acaagctgca gataaaatcc attcatcctt ccgctctctc agctctgcaa tcaatgcatc cacagggaat tatttactgg aaagtgtcaa taagctgttt ggtgagaagt ctgcgagctt ccgggaagaa tatattcgac tctgtcagaa atattactcc tcagaacccc aggcagtaga cttcctagaa tgtgcagaag aagctagaaa aaagatttat tcctgggtca agactcaaac caaaggcaaa atcccaaact tgttacctga aggttctgta gatggggata ccaggatggt cctggtgaat gctgtctact tcaaaggaaa gtggaaaact ccatttgaga agaaactaaa tgggctttat cctttccgtg taaactcggc tcagcgcaca cctgtacaga tgatgtactt gcgtgaaaag ctaaacattg gatacataga agacctaaag gctcagattc tagaactccc atatgctgga gatgttagca tgttcttgtt gcttccagat gaaattgccg atgtgtccac tggcttggag ctgctggaaa gtgaaataac ctatgacaaa ctcaacaagt ggaccagcaa agacaaaatg gctgaagatg aagttgaggt atacataccc cagttcaaat tagaagagca ttatgaactc agatccattc tgagaagcat gggcatggag gacgccttca acaagggacg ggccaatttc tcagggatgt cggagaggaa tgacctgttt ctttctgaag tgttccacca agccatggtg gatgtgaatg aggagggcac tgaagcagcc gctggcacag gaggtgttat gacagggaga actggacatg gaggcccaca gtttgtggca gatcatcctt ttctttttct tattatgcat aagataacca actgcatttt atttttcggc agattttcct caccctaa. It is sometimes possible for the material contained within the vial of "SERPINB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.