Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RFX5 cdna clone

RFX5 cDNA Clone

Synonyms
RFX5; RFX5 cDNA Clone; RFX5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagaagatgagcctgatgctaagagccccaagactgggggaagggcccccccaggtggtgctgaggctggggaacctaccacccttcttcagaggctccgaggtaccatttccaaggccgtgcagaacaaagtagaggggatcctgcaagatgtacagaaattttctgacaatgacaagctgtatctctaccttcagctcccctcaggacccaccactggagacaaaagctcagagccaagtacactgagcaatgaggagtacatgtatgcctataggtggatccgcaaccacctggaagagcacactgacacctgtctgccaaagcaaagtgtttatgatgcctatcggaagtactgtgagagtcttgcctgttgccgcccactcagcacagccaactttggcaagatcatcagagagatcttccctgacatcaaagctcgaaggcttggtggccggggccagtccaaatattgctacagtggcataaggaggaagaccttggtgtctatgccacccctgcctggacttgacctaaagggttctgagagtccagaaatgggcccagaagtaaccccagcacctcgagatgaactggtggaggcagcgtgtgccctgacctgtgactgggcagagcggatcctgaaacggtccttcagttccatcgttgaggtcgcccgcttcctgctacagcagcatctcatctctgcccgatctgcacatgcccatgtgcttaaggccatggggcttgctgaagaggacgaacatgcacctcgggaacggtcatctaaaccaaagaatggtttagagaacccagagggtggagcccacaagaagccagagagactggcccagcctcctaaggatctggaagcccgaactggggccggtcctctcgcacgtggagagcggaagaagagtgtagttgagagctcggccccaggagccaataacctgcaggttaatgccctagtggctcggctgcctctgctccttccccgggcccctcgctcactaattccgccaatcccagtctctccacctattctggcccccaggctttcttcaggtgccctgaaagtggctacactgcctctgtctagtagggccggggcacccccagcagctgtgcccatcattaacatgatcttaccaactgttcctgctttgcctggacctggacctgggcctgggcgagctccacctgggggactcactcagccccggggcacagagaacagagaggtaggcataggtggtgaccaaggaccacatgacaagggtgtcaagaggacagctgaagtacctgtgagtgaggccagtgggcaggctccaccagctaaagcagcaaagcaggatatagaggatacagcaagtgatgccaaaaggaaacgggggcgccctcgaaaaaagtcaggtggaagtggggaaaggaattctacccctctcaagtcagcagctgccatggaatctgcccagtcctcaaggttaccatgggagacatggggctcaggaggggaaggcaactcagctggaggggcagagaggccagggccaatgggagaggctgaaaagggggcagtacttgcccagggtcagggagatggtactgtttccaaaggaggaaggggccccggttcccagcataccaaagaagcagaagataaaattcccttggtcccctcaaaagtgagtgtcatcaagggcagcagaagccaaaaggaggcttttcctttggcaaagggagaggtagacactgcaccacagggtaataaagacttaaaggagcatgtgcttcaaagttccttatcccaggagcataaagacccaaaagcaacacccccatga
Sequence Length
1851
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,513 Da
NCBI Official Full Name
Homo sapiens regulatory factor X, 5 (influences HLA class II expression), mRNA
NCBI Official Synonym Full Names
regulatory factor X5
NCBI Official Symbol
RFX5
NCBI Protein Information
DNA-binding protein RFX5
UniProt Protein Name
DNA-binding protein RFX5
Protein Family
UniProt Gene Name
RFX5
UniProt Entry Name
RFX5_HUMAN

NCBI Description

A lack of MHC-II expression results in a severe immunodeficiency syndrome called MHC-II deficiency, or the bare lymphocyte syndrome (BLS; MIM 209920). At least 4 complementation groups have been identified in B-cell lines established from patients with BLS. The molecular defects in complementation groups B, C, and D all lead to a deficiency in RFX, a nuclear protein complex that binds to the X box of MHC-II promoters. The lack of RFX binding activity in complementation group C results from mutations in the RFX5 gene encoding the 75-kD subunit of RFX (Steimle et al., 1995). RFX5 is the fifth member of the growing family of DNA-binding proteins sharing a novel and highly characteristic DNA-binding domain called the RFX motif. Multiple alternatively spliced transcript variants have been found but the full-length natures of only two have been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

RFX5: Activates transcription from class II MHC promoters. Recognizes X-boxes. Mediates cooperative binding between RFX and NF-Y. RFX binds the X1 box of MHC-II promoters. Defects in RFX5 are a cause of bare lymphocyte syndrome type 2 (BLS2); also known as hereditary MHC class II deficiency or HLA class II-deficient combined immunodeficiency. BLS2 is a severe combined immunodeficiency disease with early onset. It is characterized by a profound defect in constitutive and interferon-gamma induced MHC II expression, absence of cellular and humoral T-cell response to antigen challenge, hypogammaglobulinemia and impaired antibody production. The consequence include extreme susceptibility to viral, bacterial and fungal infections. Belongs to the RFX family.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 1q21

Molecular Function: DNA binding; protein binding; transcription factor activity

Biological Process: regulation of transcription from RNA polymerase II promoter

Disease: Bare Lymphocyte Syndrome, Type Ii

Research Articles on RFX5

Similar Products

Product Notes

The RFX5 rfx5 (Catalog #AAA1271770) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaag atgagcctga tgctaagagc cccaagactg ggggaagggc ccccccaggt ggtgctgagg ctggggaacc taccaccctt cttcagaggc tccgaggtac catttccaag gccgtgcaga acaaagtaga ggggatcctg caagatgtac agaaattttc tgacaatgac aagctgtatc tctaccttca gctcccctca ggacccacca ctggagacaa aagctcagag ccaagtacac tgagcaatga ggagtacatg tatgcctata ggtggatccg caaccacctg gaagagcaca ctgacacctg tctgccaaag caaagtgttt atgatgccta tcggaagtac tgtgagagtc ttgcctgttg ccgcccactc agcacagcca actttggcaa gatcatcaga gagatcttcc ctgacatcaa agctcgaagg cttggtggcc ggggccagtc caaatattgc tacagtggca taaggaggaa gaccttggtg tctatgccac ccctgcctgg acttgaccta aagggttctg agagtccaga aatgggccca gaagtaaccc cagcacctcg agatgaactg gtggaggcag cgtgtgccct gacctgtgac tgggcagagc ggatcctgaa acggtccttc agttccatcg ttgaggtcgc ccgcttcctg ctacagcagc atctcatctc tgcccgatct gcacatgccc atgtgcttaa ggccatgggg cttgctgaag aggacgaaca tgcacctcgg gaacggtcat ctaaaccaaa gaatggttta gagaacccag agggtggagc ccacaagaag ccagagagac tggcccagcc tcctaaggat ctggaagccc gaactggggc cggtcctctc gcacgtggag agcggaagaa gagtgtagtt gagagctcgg ccccaggagc caataacctg caggttaatg ccctagtggc tcggctgcct ctgctccttc cccgggcccc tcgctcacta attccgccaa tcccagtctc tccacctatt ctggccccca ggctttcttc aggtgccctg aaagtggcta cactgcctct gtctagtagg gccggggcac ccccagcagc tgtgcccatc attaacatga tcttaccaac tgttcctgct ttgcctggac ctggacctgg gcctgggcga gctccacctg ggggactcac tcagccccgg ggcacagaga acagagaggt aggcataggt ggtgaccaag gaccacatga caagggtgtc aagaggacag ctgaagtacc tgtgagtgag gccagtgggc aggctccacc agctaaagca gcaaagcagg atatagagga tacagcaagt gatgccaaaa ggaaacgggg gcgccctcga aaaaagtcag gtggaagtgg ggaaaggaat tctacccctc tcaagtcagc agctgccatg gaatctgccc agtcctcaag gttaccatgg gagacatggg gctcaggagg ggaaggcaac tcagctggag gggcagagag gccagggcca atgggagagg ctgaaaaggg ggcagtactt gcccagggtc agggagatgg tactgtttcc aaaggaggaa ggggccccgg ttcccagcat accaaagaag cagaagataa aattcccttg gtcccctcaa aagtgagtgt catcaagggc agcagaagcc aaaaggaggc ttttcctttg gcaaagggag aggtagacac tgcaccacag ggtaataaag acttaaagga gcatgtgctt caaagttcct tatcccagga gcataaagac ccaaaagcaa cacccccatg a. It is sometimes possible for the material contained within the vial of "RFX5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.