Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPAP2C cdna clone

PPAP2C cDNA Clone

Gene Names
PLPP2; LPP2; PAP-2c; PAP2-g; PPAP2C
Synonyms
PPAP2C; PPAP2C cDNA Clone; PPAP2C cdna clone
Ordering
For Research Use Only!
Sequence
atgcagcggaggtgggtcttcgtgctgctcgacgtgctgtgcttactggtcgcctccctgcccttcgctatcctgacgctggtgaacgccccgtacaagcgaggattttactgcggggatgactccatccggtacccctaccgtccagataccatcacccacgggctcatggctggggtcaccatcacggccaccgtcatccttgtctcggccggggaagcctacctggtgtacacagaccggctctattctcgctcggacttcaacaactacgtggctgctgtatacaaggtgctggggaccttcctgtttggggctgccgtgagccagtctctgacagacctggccaagtacatgattgggcgtctgaggcccaacttcctagccgtctgcgaccccgactggagccgggtcaactgctcggtctatgtgcagctggagaaggtgtgcaggggaaaccctgctgatgtcaccgaggccaggttgtctttctactcgggacactcttcctttgggatgtactgcatggtgttcttggcgctgtatgtgcaggcacgactctgttggaagtgggcacggctgctgcgacccacagtccagttcttcctggtggcctttgccctctacgtgggctacacccgcgtgtctgattacaaacaccactggagcgatgtccttgttggcctcctgcagggggcactggtggctgccctcactgtctgctacatctcagacttcttcaaagcccgacccccacagcactgtctgaaggaggaggagctggaacggaagcccagcctgtcactgacgttgaccctgggcgaggctgaccacaaccactatggatacccgcactcctcctcctga
Sequence Length
867
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,103 Da
NCBI Official Full Name
Homo sapiens phosphatidic acid phosphatase type 2C, mRNA
NCBI Official Synonym Full Names
phospholipid phosphatase 2
NCBI Official Symbol
PLPP2
NCBI Official Synonym Symbols
LPP2; PAP-2c; PAP2-g; PPAP2C
NCBI Protein Information
phospholipid phosphatase 2
UniProt Protein Name
Phospholipid phosphatase 2
UniProt Gene Name
PLPP2
UniProt Synonym Gene Names
PAP2-G; PAP-2c; PAP2c
UniProt Entry Name
PLPP2_HUMAN

NCBI Description

The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is similar to phosphatidic acid phosphatase type 2A (PPAP2A) and type 2B (PPAP2B). All three proteins contain 6 transmembrane regions, and a consensus N-glycosylation site. This protein has been shown to possess membrane associated PAP activity. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

PPAP2C: Catalyzes the conversion of phosphatidic acid (PA) to diacylglycerol (DG). In addition it hydrolyzes lysophosphatidic acid (LPA), ceramide-1-phosphate (C-1-P) and sphingosine-1- phosphate (S-1-P). The relative catalytic efficiency is PA > C-1-P > LPA > S-1-P. Belongs to the PA-phosphatase related phosphoesterase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Lipid Metabolism - glycerophospholipid; Lipid Metabolism - glycerolipid; Lipid Metabolism - sphingolipid; Membrane protein, integral; Motility/polarity/chemotaxis; EC 3.1.3.4; Phosphatase, lipid; Lipid Metabolism - ether lipid

Chromosomal Location of Human Ortholog: 19p13

Cellular Component: integral to plasma membrane; membrane; plasma membrane

Molecular Function: lipid phosphatase activity; phosphoprotein phosphatase activity; protein binding; sphingosine-1-phosphate phosphatase activity

Biological Process: phospholipid dephosphorylation; phospholipid metabolic process; signal transduction; sphingolipid biosynthetic process

Research Articles on PPAP2C

Similar Products

Product Notes

The PPAP2C plpp2 (Catalog #AAA1277761) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagcgga ggtgggtctt cgtgctgctc gacgtgctgt gcttactggt cgcctccctg cccttcgcta tcctgacgct ggtgaacgcc ccgtacaagc gaggatttta ctgcggggat gactccatcc ggtaccccta ccgtccagat accatcaccc acgggctcat ggctggggtc accatcacgg ccaccgtcat ccttgtctcg gccggggaag cctacctggt gtacacagac cggctctatt ctcgctcgga cttcaacaac tacgtggctg ctgtatacaa ggtgctgggg accttcctgt ttggggctgc cgtgagccag tctctgacag acctggccaa gtacatgatt gggcgtctga ggcccaactt cctagccgtc tgcgaccccg actggagccg ggtcaactgc tcggtctatg tgcagctgga gaaggtgtgc aggggaaacc ctgctgatgt caccgaggcc aggttgtctt tctactcggg acactcttcc tttgggatgt actgcatggt gttcttggcg ctgtatgtgc aggcacgact ctgttggaag tgggcacggc tgctgcgacc cacagtccag ttcttcctgg tggcctttgc cctctacgtg ggctacaccc gcgtgtctga ttacaaacac cactggagcg atgtccttgt tggcctcctg cagggggcac tggtggctgc cctcactgtc tgctacatct cagacttctt caaagcccga cccccacagc actgtctgaa ggaggaggag ctggaacgga agcccagcct gtcactgacg ttgaccctgg gcgaggctga ccacaaccac tatggatacc cgcactcctc ctcctga. It is sometimes possible for the material contained within the vial of "PPAP2C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.