Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHB2 cdna clone

PHB2 cDNA Clone

Gene Names
PHB2; BAP; REA; p22; hBAP; Bap37; BCAP37; PNAS-141
Synonyms
PHB2; PHB2 cDNA Clone; PHB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccagaacttgaaggacttggcgggacggctgcccgccgggccccggggcatgggcacggccctgaagctgttgctgggggccggcgccgtggcctacggtgtgcgcgaatctgtgttcaccgtggaaggcgggcacagagccatcttcttcaatcggatcggtggagtgcagcaggacactatcctggccgagggccttcacttcaggatcccttggttccagtaccccattatctatgacattcgggccagacctcgaaaaatctcctcccctacaggctccaaagacctacagatggtgaatatctccctgcgagtgttgtctcgacccaatgctcaggagcttcctagcatgtaccagcgcctagggctggactacgaggaacgagtgttgccgtccattgtcaacgaggtgctcaagagtgtggtggccaagttcaatgcctcacagctgatcacccagcgggcccaggtatccctgttgatccgccgggagctgacagagagggccaaggacttcagcctcatcctggatgatgtggccatcacagagctgagctttagccgagagtacacagctgctgtagaagccaaacaagtggcccagcaggaggcccagcgggcccaattcttggtagaaaaagcaaagcaggaacagcggcagaaaattgtgcaggccgagggtgaggccgaggctgccaagatgcttggagaagcactgagcaagaaccctggctacatcaaacttcgcaagattcgagcagcccagaatatctccaagacgatcgccacatcacagaatcgtatctatctcacagctgacaaccttgtgctgaacctacaggatgaaagtttcaccaggggaagtgacagcctcatcaagggtaagaaatga
Sequence Length
900
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,044 Da
NCBI Official Full Name
Homo sapiens prohibitin 2, mRNA
NCBI Official Synonym Full Names
prohibitin 2
NCBI Official Symbol
PHB2
NCBI Official Synonym Symbols
BAP; REA; p22; hBAP; Bap37; BCAP37; PNAS-141
NCBI Protein Information
prohibitin-2
UniProt Protein Name
Prohibitin-2
Protein Family
UniProt Gene Name
PHB2
UniProt Entry Name
PHB2_HUMAN

Uniprot Description

BAP37: a protein of the band 7 family. This family includes the prohibitins, cytoplasmic anti-proliferative proteins and stomatin, an erythrocyte membrane protein. A repressor of estrogen receptor (ER) activity. Reverses steroid receptor coactivator 1 enhancement of ER activity. May play a role in determining the sensitivity of estrogen target cells to antiestrogen and estrogen therapy.

Protein type: Mitochondrial; Nuclear receptor co-regulator; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 12p13

Cellular Component: cell surface; cytoplasm; mitochondrial inner membrane; mitochondrial outer membrane; mitochondrion; nuclear matrix; nucleus; protein complex

Molecular Function: amide binding; protein binding; protein C-terminus binding; protein N-terminus binding

Biological Process: mitochondrion organization and biogenesis; negative regulation of apoptosis; negative regulation of transcription factor activity; negative regulation of transcription, DNA-dependent; positive regulation of exit from mitosis; positive regulation of transcription factor activity; protein import into nucleus, translocation; protein stabilization; regulation of complement activation; sister chromatid cohesion

Research Articles on PHB2

Similar Products

Product Notes

The PHB2 phb2 (Catalog #AAA1271460) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccaga acttgaagga cttggcggga cggctgcccg ccgggccccg gggcatgggc acggccctga agctgttgct gggggccggc gccgtggcct acggtgtgcg cgaatctgtg ttcaccgtgg aaggcgggca cagagccatc ttcttcaatc ggatcggtgg agtgcagcag gacactatcc tggccgaggg ccttcacttc aggatccctt ggttccagta ccccattatc tatgacattc gggccagacc tcgaaaaatc tcctccccta caggctccaa agacctacag atggtgaata tctccctgcg agtgttgtct cgacccaatg ctcaggagct tcctagcatg taccagcgcc tagggctgga ctacgaggaa cgagtgttgc cgtccattgt caacgaggtg ctcaagagtg tggtggccaa gttcaatgcc tcacagctga tcacccagcg ggcccaggta tccctgttga tccgccggga gctgacagag agggccaagg acttcagcct catcctggat gatgtggcca tcacagagct gagctttagc cgagagtaca cagctgctgt agaagccaaa caagtggccc agcaggaggc ccagcgggcc caattcttgg tagaaaaagc aaagcaggaa cagcggcaga aaattgtgca ggccgagggt gaggccgagg ctgccaagat gcttggagaa gcactgagca agaaccctgg ctacatcaaa cttcgcaaga ttcgagcagc ccagaatatc tccaagacga tcgccacatc acagaatcgt atctatctca cagctgacaa ccttgtgctg aacctacagg atgaaagttt caccagggga agtgacagcc tcatcaaggg taagaaatga. It is sometimes possible for the material contained within the vial of "PHB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.