Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRPS34 cdna clone

MRPS34 cDNA Clone

Gene Names
MRPS34; MRPS12; MRP-S12; MRP-S34
Synonyms
MRPS34; MRPS34 cDNA Clone; MRPS34 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcggaagaaggtgcgtccgcggctgatcgcggagctggcccgccgcgtgcgcgccctgcgggagcaactgaacaggccgcgcgactcccagctctacgcggtggactacgagaccttgacgcggccgttctctggacgccggctgccggtccgggcctgggccgacgtgcgccgcgagagccgcctcttgcagctgctcggccgcctcccgctcttcggcctgggccgcctggtcacgcgcaagtcctggctgtggcagcacgacgagccgtgctactggcgcctcacgcgggtgcggcccgactacacggcgcagaacttggaccacgggaaggcctggggcatcctgaccttcaaagggaagactgagagcgaggcgcgggagatcgaacacgtcatgtaccatgactggcggctggtgcccaagcacgaggaggaggccttcaccgcgttcacgccggcgccggaagacagcctggcctccgtgccgtacccgcctctcctccgggccatgattatcgcagaacgacagaaaaatggagacacaagcaccgaggagcccatgctgaatgtgcagaggatacgcatggaaccctgggattaccctgcaaaacaggaagacaaaggaagggccaagggcacccccgtctag
Sequence Length
657
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,650 Da
NCBI Official Full Name
Homo sapiens mitochondrial ribosomal protein S34, mRNA
NCBI Official Synonym Full Names
mitochondrial ribosomal protein S34
NCBI Official Symbol
MRPS34
NCBI Official Synonym Symbols
MRPS12; MRP-S12; MRP-S34
NCBI Protein Information
28S ribosomal protein S34, mitochondrial
UniProt Protein Name
28S ribosomal protein S34, mitochondrial
Protein Family
UniProt Gene Name
MRPS34
UniProt Synonym Gene Names
MRP-S34; S34mt
UniProt Entry Name
RT34_HUMAN

NCBI Description

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

MRPS34: Component of the mitochondrial ribosome small subunit (28S) which comprises a 12S rRNA and about 30 distinct proteins.

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: mitochondrial inner membrane; mitochondrion

Biological Process: mitochondrial translation

Research Articles on MRPS34

Similar Products

Product Notes

The MRPS34 mrps34 (Catalog #AAA1273342) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcgga agaaggtgcg tccgcggctg atcgcggagc tggcccgccg cgtgcgcgcc ctgcgggagc aactgaacag gccgcgcgac tcccagctct acgcggtgga ctacgagacc ttgacgcggc cgttctctgg acgccggctg ccggtccggg cctgggccga cgtgcgccgc gagagccgcc tcttgcagct gctcggccgc ctcccgctct tcggcctggg ccgcctggtc acgcgcaagt cctggctgtg gcagcacgac gagccgtgct actggcgcct cacgcgggtg cggcccgact acacggcgca gaacttggac cacgggaagg cctggggcat cctgaccttc aaagggaaga ctgagagcga ggcgcgggag atcgaacacg tcatgtacca tgactggcgg ctggtgccca agcacgagga ggaggccttc accgcgttca cgccggcgcc ggaagacagc ctggcctccg tgccgtaccc gcctctcctc cgggccatga ttatcgcaga acgacagaaa aatggagaca caagcaccga ggagcccatg ctgaatgtgc agaggatacg catggaaccc tgggattacc ctgcaaaaca ggaagacaaa ggaagggcca agggcacccc cgtctag. It is sometimes possible for the material contained within the vial of "MRPS34, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.