Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRPS27 cdna clone

MRPS27 cDNA Clone

Gene Names
MRPS27; S27mt; MRP-S27
Synonyms
MRPS27; MRPS27 cDNA Clone; MRPS27 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcctccatagtgcggcgcgggatgctcctggcgcggcaagtggttcttcctcagctctctcctgcaggtaaaagatacctgctttcttcagcctatgtagacagccacaaatgggaagcaagagaaaaagaacattactgtcttgctgatcttgcatctttaatggataaaacatttgagagaaagttgcctgttagttctttaacaatatcacggcttatagacaacatttcctctcgggaagagatagatcatgcagagtattacctttacaagtttcgacacagccccaactgctggtacctgagaaactggactatccacacctggattaggcagtgtctaaaatatgatgcacaagacaaagccctatatacccttgtaaataaggttcaatatggaatttttccagataactttacattcaatttactgatggattctttcataaagaaagaaaattacaaagatgctttatctgtggtttttgaggtcatgatgcaagaagcctttgaagtgccttccacccaacttctctccctctatgttttatttcattgcctggcaaagaagacagacttcagttgggaagaggagaggaactttggtgcatcccttttgcttccaggcctaaaacaaaagaactcagtgggtttcagttcccagttgtatggctatgcacttcttgggaaggtggagttgcagcaagggctacgggctgtgtaccacaacatgcctctgatatggaaaccaggctaccttgacagagcccttcaagtgatggagaaagtggctgcctccccagaagacataaagctgtgtagagaagcgctcgatgtgctgggtgcagtgctgaaggctctgacttcagctgatggggcttcagaggagcagtcccaaaatgatgaagacaaccaggggtcagaaaaactggtggagcagttagacatcgaggaaacagagcagtccaagcttcctcaatacctggaacgatttaaggccttacattctaagcttcaagctctgggcaaaattgagtcagaaggtcttttaagtctgaccacccagcttgtcaaggaaaaactctccacctgtgaagcagaggacatcgccacctatgagcagaatctgcagcagtggcatctagaccttgtacagttgatccagagagaacagcaacagagggagcaagcgaagcaggagtaccaggctcagaaagcagcaaaggcatctgcctaa
Sequence Length
1245
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,150 Da
NCBI Official Full Name
Homo sapiens mitochondrial ribosomal protein S27, mRNA
NCBI Official Synonym Full Names
mitochondrial ribosomal protein S27
NCBI Official Symbol
MRPS27
NCBI Official Synonym Symbols
S27mt; MRP-S27
NCBI Protein Information
28S ribosomal protein S27, mitochondrial
UniProt Protein Name
28S ribosomal protein S27, mitochondrial
Protein Family
UniProt Gene Name
MRPS27
UniProt Synonym Gene Names
KIAA0264; MRP-S27; S27mt
UniProt Entry Name
RT27_HUMAN

NCBI Description

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that may be a functional partner of the death associated protein 3 (DAP3). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]

Uniprot Description

MRPS27: Component of the mitochondrial ribosome small subunit (28S) which comprises a 12S rRNA and about 30 distinct proteins.

Protein type: Mitochondrial; Ribosomal; Translation

Chromosomal Location of Human Ortholog: 5q13.2

Cellular Component: mitochondrial inner membrane; mitochondrion

Molecular Function: protein binding

Research Articles on MRPS27

Similar Products

Product Notes

The MRPS27 mrps27 (Catalog #AAA1274624) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcct ccatagtgcg gcgcgggatg ctcctggcgc ggcaagtggt tcttcctcag ctctctcctg caggtaaaag atacctgctt tcttcagcct atgtagacag ccacaaatgg gaagcaagag aaaaagaaca ttactgtctt gctgatcttg catctttaat ggataaaaca tttgagagaa agttgcctgt tagttcttta acaatatcac ggcttataga caacatttcc tctcgggaag agatagatca tgcagagtat tacctttaca agtttcgaca cagccccaac tgctggtacc tgagaaactg gactatccac acctggatta ggcagtgtct aaaatatgat gcacaagaca aagccctata tacccttgta aataaggttc aatatggaat ttttccagat aactttacat tcaatttact gatggattct ttcataaaga aagaaaatta caaagatgct ttatctgtgg tttttgaggt catgatgcaa gaagcctttg aagtgccttc cacccaactt ctctccctct atgttttatt tcattgcctg gcaaagaaga cagacttcag ttgggaagag gagaggaact ttggtgcatc ccttttgctt ccaggcctaa aacaaaagaa ctcagtgggt ttcagttccc agttgtatgg ctatgcactt cttgggaagg tggagttgca gcaagggcta cgggctgtgt accacaacat gcctctgata tggaaaccag gctaccttga cagagccctt caagtgatgg agaaagtggc tgcctcccca gaagacataa agctgtgtag agaagcgctc gatgtgctgg gtgcagtgct gaaggctctg acttcagctg atggggcttc agaggagcag tcccaaaatg atgaagacaa ccaggggtca gaaaaactgg tggagcagtt agacatcgag gaaacagagc agtccaagct tcctcaatac ctggaacgat ttaaggcctt acattctaag cttcaagctc tgggcaaaat tgagtcagaa ggtcttttaa gtctgaccac ccagcttgtc aaggaaaaac tctccacctg tgaagcagag gacatcgcca cctatgagca gaatctgcag cagtggcatc tagaccttgt acagttgatc cagagagaac agcaacagag ggagcaagcg aagcaggagt accaggctca gaaagcagca aaggcatctg cctaa. It is sometimes possible for the material contained within the vial of "MRPS27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.