Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRPS2 cdna clone

MRPS2 cDNA Clone

Gene Names
MRPS2; S2mt; CGI-91; MRP-S2
Synonyms
MRPS2; MRPS2 cDNA Clone; MRPS2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacatcctcggccgcgctgccccgaatactcggcgcgggtgcccgggccccgtcgcgctggttgggctttctcgggaaggcgaccccccggcctgctcggccgagccgcaggacgcttggaagcgcgacggcccttatgatccgcgagtcggaggacagcaccgatttcaacgacaagattttgaatgagcccctcaagcactctgacttcttcaatgtcaaggaactgttttccgtgagaagcctcttcgatgcccgagtccatctgggacacaaagctggctgtcggcacaggtttatggagccgtacatctttgggagccgcctggaccacgacatcatcgacctggaacagacagccacgcacctccagctggccttgaacttcaccgcccacatggcctaccgcaagggcatcatcttgtttataagccgcaaccggcagttctcgtacctgattgagaacatggcccgtgactgtggcgagtacgcccacactcgctacttcaggggcggcatgctgaccaacgcgcgcctcctctttggccccacggtccgcctgccggacctcatcatcttcctgcacacgctcaacaacatctttgagccacacgtggccgtgagagacgcagccaagatgaacatccccacagtgggcatcgtggacaccaactgcaacccctgcctcatcacctaccctgtacccggcaatgacgactctccgctggctgtgcacctctactgcaggctcttccagacggccatcacccgggccaaggagaagcggcagcaggttgaggctctctatcgcctgcagggccagaaggagcccggggaccaggggccagcccaccctcctggggctgacatgagccattccctgtga
Sequence Length
891
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,249 Da
NCBI Official Full Name
Homo sapiens mitochondrial ribosomal protein S2, mRNA
NCBI Official Synonym Full Names
mitochondrial ribosomal protein S2
NCBI Official Symbol
MRPS2
NCBI Official Synonym Symbols
S2mt; CGI-91; MRP-S2
NCBI Protein Information
28S ribosomal protein S2, mitochondrial
UniProt Protein Name
28S ribosomal protein S2, mitochondrial
Protein Family
UniProt Gene Name
MRPS2
UniProt Synonym Gene Names
MRP-S2; S2mt
UniProt Entry Name
RT02_HUMAN

NCBI Description

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S2 family. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]

Uniprot Description

MRPS2: a mitochondrial ribosomal protein encoded by a nuclear gene that helps in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S2 family. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]

Protein type: Ribosomal; Mitochondrial; Translation

Chromosomal Location of Human Ortholog: 9q34

Cellular Component: mitochondrial small ribosomal subunit; mitochondrion

Molecular Function: structural constituent of ribosome

Biological Process: mitochondrial translation; positive regulation of defense response to virus by host; translation

Research Articles on MRPS2

Similar Products

Product Notes

The MRPS2 mrps2 (Catalog #AAA1267530) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacat cctcggccgc gctgccccga atactcggcg cgggtgcccg ggccccgtcg cgctggttgg gctttctcgg gaaggcgacc ccccggcctg ctcggccgag ccgcaggacg cttggaagcg cgacggccct tatgatccgc gagtcggagg acagcaccga tttcaacgac aagattttga atgagcccct caagcactct gacttcttca atgtcaagga actgttttcc gtgagaagcc tcttcgatgc ccgagtccat ctgggacaca aagctggctg tcggcacagg tttatggagc cgtacatctt tgggagccgc ctggaccacg acatcatcga cctggaacag acagccacgc acctccagct ggccttgaac ttcaccgccc acatggccta ccgcaagggc atcatcttgt ttataagccg caaccggcag ttctcgtacc tgattgagaa catggcccgt gactgtggcg agtacgccca cactcgctac ttcaggggcg gcatgctgac caacgcgcgc ctcctctttg gccccacggt ccgcctgccg gacctcatca tcttcctgca cacgctcaac aacatctttg agccacacgt ggccgtgaga gacgcagcca agatgaacat ccccacagtg ggcatcgtgg acaccaactg caacccctgc ctcatcacct accctgtacc cggcaatgac gactctccgc tggctgtgca cctctactgc aggctcttcc agacggccat cacccgggcc aaggagaagc ggcagcaggt tgaggctctc tatcgcctgc agggccagaa ggagcccggg gaccaggggc cagcccaccc tcctggggct gacatgagcc attccctgtg a. It is sometimes possible for the material contained within the vial of "MRPS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.