MRPL14 cdna clone
MRPL14 cDNA Clone
Gene Names
MRPL14; L14mt; L32mt; MRPL32; RMPL32; RPML32; MRP-L14; MRP-L32
Synonyms
MRPL14; MRPL14 cDNA Clone; MRPL14 cdna clone
Sequence
atggctttctttactgggctctggggccccttcacctgtgtaagcagagtgctgagccatcactgtttcagcaccactgggagtctgagtgcgattcagaagatgacgcgggtacgagtggtggacaacagtgccctggggaacagcccataccatcgggctcctcgctgcatccatgtctataagaagaatggagtgggcaaggtgggcgaccagatactactggccatcaagggacagaagaaaaaggcgctcattgtggggcactgcatgcctggcccccgaatgacccccagattcgactccaacaacgtggtcctcattgaggacaacgggaaccctgtggggacacgaattaagacacccatccccaccagcctgcgcaagcgggaaggcgagtattccaaggtgctggccattgctcagaactttgtgtga
Sequence Length
438
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,948 Da
NCBI Official Full Name
Homo sapiens mitochondrial ribosomal protein L14, mRNA
NCBI Official Synonym Full Names
mitochondrial ribosomal protein L14
NCBI Official Symbol
MRPL14
NCBI Official Synonym Symbols
L14mt; L32mt; MRPL32; RMPL32; RPML32; MRP-L14; MRP-L32
NCBI Protein Information
39S ribosomal protein L14, mitochondrial
UniProt Protein Name
39S ribosomal protein L14, mitochondrial
Protein Family
UniProt Gene Name
MRPL14
UniProt Synonym Gene Names
MRPL32; RPML32; L14mt; MRP-L14; L32mt; MRP-L32
UniProt Entry Name
RM14_HUMAN
NCBI Description
This nuclear gene encodes a protein component of the 39S subunit of the mitochondrial ribosome. A pseudogene of this gene is found on chromosome 17. [provided by RefSeq, Jan 2016]
Uniprot Description
MRPL14: Forms part of 2 intersubunit bridges in the assembled ribosome. Upon binding to MALSU1 intersubunit bridge formation is blocked, preventing ribosome formation and repressing translation (Probable). Belongs to the ribosomal protein L14P family.
Protein type: Mitochondrial; Translation; Ribosomal
Chromosomal Location of Human Ortholog: 6p21.3
Cellular Component: mitochondrial inner membrane; mitochondrion
Research Articles on MRPL14
Similar Products
Product Notes
The MRPL14 mrpl14 (Catalog #AAA1273036) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctttct ttactgggct ctggggcccc ttcacctgtg taagcagagt gctgagccat cactgtttca gcaccactgg gagtctgagt gcgattcaga agatgacgcg ggtacgagtg gtggacaaca gtgccctggg gaacagccca taccatcggg ctcctcgctg catccatgtc tataagaaga atggagtggg caaggtgggc gaccagatac tactggccat caagggacag aagaaaaagg cgctcattgt ggggcactgc atgcctggcc cccgaatgac ccccagattc gactccaaca acgtggtcct cattgaggac aacgggaacc ctgtggggac acgaattaag acacccatcc ccaccagcct gcgcaagcgg gaaggcgagt attccaaggt gctggccatt gctcagaact ttgtgtga. It is sometimes possible for the material contained within the vial of "MRPL14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
