Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRPL12 cdna clone

MRPL12 cDNA Clone

Gene Names
MRPL12; 5c5-2; L12mt; MRPL7; RPML12; MRPL7/L12; MRP-L31/34
Synonyms
MRPL12; MRPL12 cDNA Clone; MRPL12 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgccggcggccgctcgccccctgtgggggccttgccttgggcttcgggccgctgcgttccgccttgccaggcgacaggtgccatgtgtctgtgccgtgcgacatatgaggagcagcggccatcagaggtgtgaggccctcgctggtgcacccctggataacgcccccaaggagtacccccccaagatacagcagctggtccaggacatcgccagcctcactctcttggaaatctcagacctcaacgagctcctgaagaaaacgttgaagatccaggatgtcgggcttgtgccgatgggtggtgtgatgtctggggctgtccctgctgcagcagcccaggaggcggtggaagaagatatccccatagcgaaagaacggacacatttcaccgtccgcctgaccgaggcgaagcccgtggacaaagtgaagctgatcaaggaaatcaagaactacatccaaggcatcaacctcgtccaggcaaagaagctggtggagtccctgccccaggaaatcaaagccaatgtcgccaaagctgaggcggagaagatcaaggcggccctggaggcggtgggcggcaccgtggttctggagtag
Sequence Length
597
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,348 Da
NCBI Official Full Name
Homo sapiens mitochondrial ribosomal protein L12, mRNA
NCBI Official Synonym Full Names
mitochondrial ribosomal protein L12
NCBI Official Symbol
MRPL12
NCBI Official Synonym Symbols
5c5-2; L12mt; MRPL7; RPML12; MRPL7/L12; MRP-L31/34
NCBI Protein Information
39S ribosomal protein L12, mitochondrial
UniProt Protein Name
39S ribosomal protein L12, mitochondrial
Protein Family
UniProt Gene Name
MRPL12
UniProt Synonym Gene Names
RPML12; L12mt; MRP-L12
UniProt Entry Name
RM12_HUMAN

NCBI Description

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein which forms homodimers. In prokaryotic ribosomes, two L7/L12 dimers and one L10 protein form the L8 protein complex. [provided by RefSeq, Jul 2008]

Uniprot Description

MRPL12: a mitochondrial ribosomal protein encoded by a nuclear gene that helps in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein which forms homodimers. In prokaryotic ribosomes, two L7/L12 dimers and one L10 protein form the L8 protein complex. [provided by RefSeq, Jul 2008]

Protein type: Mitochondrial; Ribosomal

Chromosomal Location of Human Ortholog: 17q25

Cellular Component: mitochondrial inner membrane; mitochondrial large ribosomal subunit; mitochondrion

Molecular Function: protein binding; RNA binding

Biological Process: positive regulation of transcription, DNA-dependent; transcription from mitochondrial promoter

Research Articles on MRPL12

Similar Products

Product Notes

The MRPL12 mrpl12 (Catalog #AAA1272592) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgccgg cggccgctcg ccccctgtgg gggccttgcc ttgggcttcg ggccgctgcg ttccgccttg ccaggcgaca ggtgccatgt gtctgtgccg tgcgacatat gaggagcagc ggccatcaga ggtgtgaggc cctcgctggt gcacccctgg ataacgcccc caaggagtac ccccccaaga tacagcagct ggtccaggac atcgccagcc tcactctctt ggaaatctca gacctcaacg agctcctgaa gaaaacgttg aagatccagg atgtcgggct tgtgccgatg ggtggtgtga tgtctggggc tgtccctgct gcagcagccc aggaggcggt ggaagaagat atccccatag cgaaagaacg gacacatttc accgtccgcc tgaccgaggc gaagcccgtg gacaaagtga agctgatcaa ggaaatcaag aactacatcc aaggcatcaa cctcgtccag gcaaagaagc tggtggagtc cctgccccag gaaatcaaag ccaatgtcgc caaagctgag gcggagaaga tcaaggcggc cctggaggcg gtgggcggca ccgtggttct ggagtag. It is sometimes possible for the material contained within the vial of "MRPL12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.