Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRPL11 cdna clone

MRPL11 cDNA Clone

Gene Names
MRPL11; L11MT; CGI-113; MRP-L11
Synonyms
MRPL11; MRPL11 cDNA Clone; MRPL11 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaaagctcggccgggccgcccggggcctcaggaagcccgaggtcggcggtgtaatccgggcgatcgtgcgggcaggcctggccatgcccgggcccccactaggcccagtgctgggtcagagaggcgtttccatcaaccagttttgcaaggagttcaatgagaggacaaaggacatcaaggaaggcattcctctgcctaccaagattttagtgaagcctgacaggacatttgaaattaagattggacagcccactgtttcctacttcctgaaggcagcagctgggattgaaaagggggcccggcaaacagggaaagaggtggcaggcctggtgaccttgaagcatgtgtatgagattgcccgcatcaaagctcaggatgaggcatttgccctgcaggatgtacccctgtcgtctgttgtccgctccatcatcgggtctgcccgttctctgggcattcgcgtggtgaaggacctcagttcagaagagcttgcagctttccagaaggaacgagccatcttcctggctgctcagaaggaggcagatttggctgcccaagaagaagctgccaagaagtga
Sequence Length
579
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,454 Da
NCBI Official Full Name
Homo sapiens mitochondrial ribosomal protein L11, mRNA
NCBI Official Synonym Full Names
mitochondrial ribosomal protein L11
NCBI Official Symbol
MRPL11
NCBI Official Synonym Symbols
L11MT; CGI-113; MRP-L11
NCBI Protein Information
39S ribosomal protein L11, mitochondrial
UniProt Protein Name
39S ribosomal protein L11, mitochondrial
Protein Family
UniProt Gene Name
MRPL11
UniProt Synonym Gene Names
L11mt; MRP-L11
UniProt Entry Name
RM11_HUMAN

NCBI Description

This nuclear gene encodes a 39S subunit component of the mitochondial ribosome. Alternative splicing results in multiple transcript variants. Pseudogenes for this gene are found on chromosomes 5 and 12. [provided by RefSeq, May 2014]

Uniprot Description

MRPL11: Belongs to the ribosomal protein L11P family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ribosomal; Mitochondrial; RNA-binding

Chromosomal Location of Human Ortholog: 11q13.3

Cellular Component: mitochondrial inner membrane; mitochondrial large ribosomal subunit

Molecular Function: protein binding; rRNA binding; structural constituent of ribosome

Biological Process: ribosomal large subunit assembly and maintenance; translation

Similar Products

Product Notes

The MRPL11 mrpl11 (Catalog #AAA1266916) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaaagc tcggccgggc cgcccggggc ctcaggaagc ccgaggtcgg cggtgtaatc cgggcgatcg tgcgggcagg cctggccatg cccgggcccc cactaggccc agtgctgggt cagagaggcg tttccatcaa ccagttttgc aaggagttca atgagaggac aaaggacatc aaggaaggca ttcctctgcc taccaagatt ttagtgaagc ctgacaggac atttgaaatt aagattggac agcccactgt ttcctacttc ctgaaggcag cagctgggat tgaaaagggg gcccggcaaa cagggaaaga ggtggcaggc ctggtgacct tgaagcatgt gtatgagatt gcccgcatca aagctcagga tgaggcattt gccctgcagg atgtacccct gtcgtctgtt gtccgctcca tcatcgggtc tgcccgttct ctgggcattc gcgtggtgaa ggacctcagt tcagaagagc ttgcagcttt ccagaaggaa cgagccatct tcctggctgc tcagaaggag gcagatttgg ctgcccaaga agaagctgcc aagaagtga. It is sometimes possible for the material contained within the vial of "MRPL11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.