Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MORF4L1 cdna clone

MORF4L1 cDNA Clone

Gene Names
MORF4L1; Eaf3; MEAF3; MRG15; FWP006; S863-6; HsT17725; MORFRG15
Synonyms
MORF4L1; MORF4L1 cDNA Clone; MORF4L1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgccgaagcaggacccgaagcctaaattccaggagggtgagcgagtgctgtgctttcatgggcctcttctttatgaagcaaagtgtgtaaaggttgccataaaggacaaacaagtgaaatacttcatacattacagtggttggaataaaaattgggatgaatgggttccggagagcagagtactcaaatacgtggacaccaatttgcagaaacagcgagaacttcaaaaagccaatcaggagcagtatgcagaggggaagatgagaggggctgccccaggaaagaagacatctggtctgcaacagaaaaatgttgaagtgaaaacgaaaaagaacaaacagaaaacacctggaaatggagatggtggcagtaccagtgagacccctcagcctcctcggaagaaaagggcccgggtagatcctactgttgaaaatgaggaaacattcatgaacagagttgaagttaaagtaaagattcctgaagagctaaaaccgtggcttgttgatgactgggacttaattaccaggcaaaaacagctcttttatcttcctgccaagaagaatgtggattccattcttgaggattatgcaaattacaagaaatctcgtggaaacacagataataaggagtatgcggttaatgaagttgtggcagggataaaagaatacttcaacgtaatgttgggtacccagctactctataaatttgagagaccacagtatgctgaaattcttgcagatcatcccgatgcacccatgtcccaggtgtatggagcgccacatctcctgagattatttgtacgaattggagcaatgttggcttatacacctctggatgagaagagccttgctttattactcaattatcttcacgatttcctaaagtacctggcaaagaattctgcaactttgttcagtgccagcgattatgaagtggctcctcctgagtaccatcggaaagctgtgtga
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,750 Da
NCBI Official Full Name
Homo sapiens mortality factor 4 like 1, mRNA
NCBI Official Synonym Full Names
mortality factor 4 like 1
NCBI Official Symbol
MORF4L1
NCBI Official Synonym Symbols
Eaf3; MEAF3; MRG15; FWP006; S863-6; HsT17725; MORFRG15
NCBI Protein Information
mortality factor 4-like protein 1
UniProt Protein Name
Mortality factor 4-like protein 1
UniProt Gene Name
MORF4L1
UniProt Synonym Gene Names
MRG15
UniProt Entry Name
MO4L1_HUMAN

Uniprot Description

MORF4L1: Component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the mSin3A complex which acts to repress transcription by deacetylation of nucleosomal histones. Required for homologous recombination repair (HRR) and resistance to mitomycin C (MMC). Involved in the localization of PALB2, BRCA2 and RAD51, but not BRCA1, to DNA-damage foci. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 15q24

Cellular Component: NuA4 histone acetyltransferase complex; nucleoplasm; Sin3 complex

Molecular Function: protein binding; protein N-terminus binding

Biological Process: chromatin remodeling; chromatin silencing; double-strand break repair via homologous recombination; histone deacetylation

Research Articles on MORF4L1

Similar Products

Product Notes

The MORF4L1 morf4l1 (Catalog #AAA1268315) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccga agcaggaccc gaagcctaaa ttccaggagg gtgagcgagt gctgtgcttt catgggcctc ttctttatga agcaaagtgt gtaaaggttg ccataaagga caaacaagtg aaatacttca tacattacag tggttggaat aaaaattggg atgaatgggt tccggagagc agagtactca aatacgtgga caccaatttg cagaaacagc gagaacttca aaaagccaat caggagcagt atgcagaggg gaagatgaga ggggctgccc caggaaagaa gacatctggt ctgcaacaga aaaatgttga agtgaaaacg aaaaagaaca aacagaaaac acctggaaat ggagatggtg gcagtaccag tgagacccct cagcctcctc ggaagaaaag ggcccgggta gatcctactg ttgaaaatga ggaaacattc atgaacagag ttgaagttaa agtaaagatt cctgaagagc taaaaccgtg gcttgttgat gactgggact taattaccag gcaaaaacag ctcttttatc ttcctgccaa gaagaatgtg gattccattc ttgaggatta tgcaaattac aagaaatctc gtggaaacac agataataag gagtatgcgg ttaatgaagt tgtggcaggg ataaaagaat acttcaacgt aatgttgggt acccagctac tctataaatt tgagagacca cagtatgctg aaattcttgc agatcatccc gatgcaccca tgtcccaggt gtatggagcg ccacatctcc tgagattatt tgtacgaatt ggagcaatgt tggcttatac acctctggat gagaagagcc ttgctttatt actcaattat cttcacgatt tcctaaagta cctggcaaag aattctgcaa ctttgttcag tgccagcgat tatgaagtgg ctcctcctga gtaccatcgg aaagctgtgt ga. It is sometimes possible for the material contained within the vial of "MORF4L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.