Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MDM4 cdna clone

MDM4 cDNA Clone

Gene Names
MDM4; HDMX; MDMX; MRP1
Synonyms
MDM4; MDM4 cDNA Clone; MDM4 cdna clone
Ordering
For Research Use Only!
Sequence
atgacatcattttccacctctgctcagtgttcaacatctgacagtgcttgcaggatctctcctggacaaatcaatcaggtacgaccaaaactgccgcttttgaagattttgcatgcagcaggtgcgcaaggtgaaatgttcactgttaaagaggtcatgcactatttaggtcagtacataatggtgaagcaactttatgatcagcaggagcagcatatggtatattgtggtggagatcttttgggagaactactgggacgtcagagcttctccgtgaaagacccaagccctctctatgatatgctaagaaagaatcttgtcactttagccactgctactacagatgctgctcagactctcgctctcgcacaggatcacagtatggatattccaagtcaagaccaactgaagcaaagtgcagaggaaagttccacttccagaaaaagaactacagaagacgatatccccacactgcctacctcagagcataaatgcatacattctagagaagatgaagacttaattgaaaatttagcccaagatgaaacatctaggctggaccttggatttgaggagtgggatgtagctggcctgccttggtggtttttaggaaacttgagaagcaactatacacctagaagtaatggctcaactgatttacagacaaatcaggatgtgggtactgccattgtttcagatactacagatgacttgtggtttttgaatgagtcagtatcagagcagttaggtgttggaataaaagttgaagctgctgatactgaacaaacaagtgaagaagtagggaaagtaagtgacaaaaaggtgattgaagtgggaaaaaatgatgacctggaggactctaagtccttaagtgatgataccgatgtagaggttacctctgaggatgagtggcagtgtactgaatgcaagaaatttaactctccaagcaagaggtactgttttcgttgttgggccttgaggaaggattggtattcagattgttcaaagttaacccattctctctccacgtctgatatcactgccatacctgaaaaggaaaatgaaggaaatgatgtccctgattgtcgaagaaccatttcggctcctgtcgttagacctaaagatgcgtatataaagaaagaaaactccaaactttttgatccctgcaactcagtggaattcttggatttggctcacagttctgaaagccaagagaccatctcaagcatgggagaacagttagataacctttctgaacagagaacagatacagaaaacatggaggattgccagaatctcttgaagccatgtagcttatgtgagaaaagaccacgagacgggaacattattcatggaaggacgggccatcttgtcacttgttttcactgtgccagaagactaaagaaggctggggcttcatgccctatttgcaagaaagagattcagctggttattaaggtttttatagcataa
Sequence Length
1473
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,541 Da
NCBI Official Full Name
Homo sapiens Mdm4 p53 binding protein homolog (mouse), mRNA
NCBI Official Synonym Full Names
MDM4, p53 regulator
NCBI Official Symbol
MDM4
NCBI Official Synonym Symbols
HDMX; MDMX; MRP1
NCBI Protein Information
protein Mdm4
UniProt Protein Name
Protein Mdm4
Protein Family
UniProt Gene Name
MDM4
UniProt Synonym Gene Names
MDMX
UniProt Entry Name
MDM4_HUMAN

NCBI Description

This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Feb 2011]

Uniprot Description

MDM4: Inhibits p53/TP53- and TP73/p73-mediated cell cycle arrest and apoptosis by binding its transcriptional activation domain. Inhibits degradation of MDM2. Can reverse MDM2-targeted degradation of TP53 while maintaining suppression of TP53 transactivation and apoptotic functions. Interacts with MDM2, TP53, TP73 and USP2. Found in a trimeric complex with UPB2, MDM2 and MDM4. Interacts (phosphorylated) with YWHAG; negatively regulates MDM4 activity toward TP53. Down-regulated by cisplatin. Expressed in all tissues tested with high levels in thymus. Belongs to the MDM2/MDM4 family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin ligase; EC 6.3.2.-; Ligase; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: nucleoplasm; nucleus

Molecular Function: enzyme binding; protein binding; zinc ion binding

Biological Process: cell proliferation; DNA damage response, signal transduction by p53 class mediator; DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; G0 to G1 transition; negative regulation of cell proliferation; negative regulation of protein catabolic process; negative regulation of transcription from RNA polymerase II promoter; protein complex assembly; protein stabilization

Research Articles on MDM4

Similar Products

Product Notes

The MDM4 mdm4 (Catalog #AAA1275346) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacatcat tttccacctc tgctcagtgt tcaacatctg acagtgcttg caggatctct cctggacaaa tcaatcaggt acgaccaaaa ctgccgcttt tgaagatttt gcatgcagca ggtgcgcaag gtgaaatgtt cactgttaaa gaggtcatgc actatttagg tcagtacata atggtgaagc aactttatga tcagcaggag cagcatatgg tatattgtgg tggagatctt ttgggagaac tactgggacg tcagagcttc tccgtgaaag acccaagccc tctctatgat atgctaagaa agaatcttgt cactttagcc actgctacta cagatgctgc tcagactctc gctctcgcac aggatcacag tatggatatt ccaagtcaag accaactgaa gcaaagtgca gaggaaagtt ccacttccag aaaaagaact acagaagacg atatccccac actgcctacc tcagagcata aatgcataca ttctagagaa gatgaagact taattgaaaa tttagcccaa gatgaaacat ctaggctgga ccttggattt gaggagtggg atgtagctgg cctgccttgg tggtttttag gaaacttgag aagcaactat acacctagaa gtaatggctc aactgattta cagacaaatc aggatgtggg tactgccatt gtttcagata ctacagatga cttgtggttt ttgaatgagt cagtatcaga gcagttaggt gttggaataa aagttgaagc tgctgatact gaacaaacaa gtgaagaagt agggaaagta agtgacaaaa aggtgattga agtgggaaaa aatgatgacc tggaggactc taagtcctta agtgatgata ccgatgtaga ggttacctct gaggatgagt ggcagtgtac tgaatgcaag aaatttaact ctccaagcaa gaggtactgt tttcgttgtt gggccttgag gaaggattgg tattcagatt gttcaaagtt aacccattct ctctccacgt ctgatatcac tgccatacct gaaaaggaaa atgaaggaaa tgatgtccct gattgtcgaa gaaccatttc ggctcctgtc gttagaccta aagatgcgta tataaagaaa gaaaactcca aactttttga tccctgcaac tcagtggaat tcttggattt ggctcacagt tctgaaagcc aagagaccat ctcaagcatg ggagaacagt tagataacct ttctgaacag agaacagata cagaaaacat ggaggattgc cagaatctct tgaagccatg tagcttatgt gagaaaagac cacgagacgg gaacattatt catggaagga cgggccatct tgtcacttgt tttcactgtg ccagaagact aaagaaggct ggggcttcat gccctatttg caagaaagag attcagctgg ttattaaggt ttttatagca taa. It is sometimes possible for the material contained within the vial of "MDM4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.