Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLK15 cdna clone

KLK15 cDNA Clone

Gene Names
KLK15; ACO; HSRNASPH
Synonyms
KLK15; KLK15 cDNA Clone; KLK15 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggcttctcctcactctctccttcctgctggcatccacagcagcccaggatggtgacaagttgctggaaggtgacgagtgtgcaccccactcccagccatggcaagtggctctctacgagcgtggacgctttaactgtggcgcttccctcatctccccacactgggtgctgtctgcggcccactgccaaagccgcttcatgagagtgcgcctgggagagcacaacctgcgcaagcgcgatggcccagagcaactacggaccacgtctcgggtcattccacacccgcgctacgaagcgcgcagccaccgcaacgacatcatgttgctgcgcctagtccagcccgcacgcctgaacccccaggtgcgccccgcggtgctacccacgcgttgcccccacccgggggaggcctgtgtggtgtctggctggggcctggtgtcccacaacgagcctgggaccgctgggagcccccggtcacaagtgagtctcccagatacgttgcattgtgccaacatcagcattatctcggacacatcttgtgacaagagctacccagggcgcctgacaaacaccatggtgtgtgcaggcgcggagggcagaggcgcagaatcctgtgagggtgactctgggggacccctggtctgtgggggcatcctgcagggcattgtgtcctggggtgacgtcccttgtgacaacaccaccaagcctggtgtctataccaaagtctgccactacttggagtggatcagggaaaccatgaagaggaactga
Sequence Length
771
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,016 Da
NCBI Official Full Name
Homo sapiens kallikrein-related peptidase 15, mRNA
NCBI Official Synonym Full Names
kallikrein related peptidase 15
NCBI Official Symbol
KLK15
NCBI Official Synonym Symbols
ACO; HSRNASPH
UniProt Protein Name
Kallikrein-15
Protein Family
UniProt Gene Name
KLK15
UniProt Entry Name
KLK15_HUMAN

NCBI Description

Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

KLK15: Protease whose physiological substrate is not yet known. Belongs to the peptidase S1 family. Kallikrein subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.21.-; Protease; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 19q13.41

Molecular Function: protein binding; serine-type peptidase activity

Research Articles on KLK15

Similar Products

Product Notes

The KLK15 klk15 (Catalog #AAA1274756) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggcttc tcctcactct ctccttcctg ctggcatcca cagcagccca ggatggtgac aagttgctgg aaggtgacga gtgtgcaccc cactcccagc catggcaagt ggctctctac gagcgtggac gctttaactg tggcgcttcc ctcatctccc cacactgggt gctgtctgcg gcccactgcc aaagccgctt catgagagtg cgcctgggag agcacaacct gcgcaagcgc gatggcccag agcaactacg gaccacgtct cgggtcattc cacacccgcg ctacgaagcg cgcagccacc gcaacgacat catgttgctg cgcctagtcc agcccgcacg cctgaacccc caggtgcgcc ccgcggtgct acccacgcgt tgcccccacc cgggggaggc ctgtgtggtg tctggctggg gcctggtgtc ccacaacgag cctgggaccg ctgggagccc ccggtcacaa gtgagtctcc cagatacgtt gcattgtgcc aacatcagca ttatctcgga cacatcttgt gacaagagct acccagggcg cctgacaaac accatggtgt gtgcaggcgc ggagggcaga ggcgcagaat cctgtgaggg tgactctggg ggacccctgg tctgtggggg catcctgcag ggcattgtgt cctggggtga cgtcccttgt gacaacacca ccaagcctgg tgtctatacc aaagtctgcc actacttgga gtggatcagg gaaaccatga agaggaactg a. It is sometimes possible for the material contained within the vial of "KLK15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.