Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLC3 cdna clone

KLC3 cDNA Clone

Gene Names
KLC3; KLC2; KLCt; KLC2L; KNS2B
Synonyms
KLC3; KLC3 cDNA Clone; KLC3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgtgcaggtagcggctcctggaagtgcagggctgggcccagagcgcctgagccctgaggagctggtgcggcagacgcggcaagtggtccaggggctggaggcgctgcgggcagagcaccatggcctggctgggcacctggcggaggccctggcgggacagggcccggcagccggcttggagatgctggaggaaaagcagcaggtggtgagccactcgctggaggccatcgagctggggctgggcgaggcccaggtgctgctggccctgtcggcacatgtgggtgcactggaggcagagaagcagcggctgcgctcgcaggcccggcggctggcccaggagaacgtgtggctgcgggaggaactggaggagacgcagcggcggcttcgggccagcgaggagtccgtggcccagctggaggaggagaagcgccacctggagttcctggggcagctgcgacagtacgacccaccggcggagagccaggtgccacgggcagggcgaggcggggggtgctgggcccttcatagagccccacagtcccccagaccctccttagaatcccacagtccccaagatcctccttag
Sequence Length
591
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,793 Da
NCBI Official Full Name
Homo sapiens kinesin light chain 3, mRNA
NCBI Official Synonym Full Names
kinesin light chain 3
NCBI Official Symbol
KLC3
NCBI Official Synonym Symbols
KLC2; KLCt; KLC2L; KNS2B
NCBI Protein Information
kinesin light chain 3
UniProt Protein Name
Kinesin light chain 3
Protein Family
UniProt Gene Name
KLC3
UniProt Synonym Gene Names
KLC2; KLC2L
UniProt Entry Name
KLC3_HUMAN

NCBI Description

This gene encodes a member of the kinesin light chain gene family. Kinesins are molecular motors involved in the transport of cargo along microtubules, and are composed of two kinesin heavy chain (KHC) and two kinesin light chain (KLC) molecules. KLCs are thought to typically be involved in binding cargo and regulating kinesin activity. In the rat, a protein similar to this gene product is expressed in post-meiotic spermatids, where it associates with structural components of sperm tails and mitochondria. [provided by RefSeq, Jul 2008]

Uniprot Description

KLC3: Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. Belongs to the kinesin light chain family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Microtubule-binding; Motor

Chromosomal Location of Human Ortholog: 19q13

Molecular Function: protein binding

Research Articles on KLC3

Similar Products

Product Notes

The KLC3 klc3 (Catalog #AAA1272456) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgtgc aggtagcggc tcctggaagt gcagggctgg gcccagagcg cctgagccct gaggagctgg tgcggcagac gcggcaagtg gtccaggggc tggaggcgct gcgggcagag caccatggcc tggctgggca cctggcggag gccctggcgg gacagggccc ggcagccggc ttggagatgc tggaggaaaa gcagcaggtg gtgagccact cgctggaggc catcgagctg gggctgggcg aggcccaggt gctgctggcc ctgtcggcac atgtgggtgc actggaggca gagaagcagc ggctgcgctc gcaggcccgg cggctggccc aggagaacgt gtggctgcgg gaggaactgg aggagacgca gcggcggctt cgggccagcg aggagtccgt ggcccagctg gaggaggaga agcgccacct ggagttcctg gggcagctgc gacagtacga cccaccggcg gagagccagg tgccacgggc agggcgaggc ggggggtgct gggcccttca tagagcccca cagtccccca gaccctcctt agaatcccac agtccccaag atcctcctta g. It is sometimes possible for the material contained within the vial of "KLC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.