Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNAB1 cdna clone

KCNAB1 cDNA Clone

Gene Names
KCNAB1; hKvb3; AKR6A3; KCNA1B; Kvb1.3; hKvBeta3; KV-BETA-1
Synonyms
KCNAB1; KCNAB1 cDNA Clone; KCNAB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaagtctccatagcctgcacagagcacaatttgaagagtcggaatggtgaggaccgacttctgagcaagcagagctccaccgcccccaatgtggtaaacgcagcccgggccaaattccgcacggtcgctatcatcgcgcgcagcctggggacgttcacgcctcagcatcacatttctctcaaagagtccaccgcaaagcagactggcatgaaatataggaatcttggaaaatcaggactcagagtttcttgcttgggtcttggaacatgggtgacatttggaggtcaaatttcagatgaggttgctgaacggctgatgaccatcgcctatgaaagtggtgttaacctctttgatactgccgaagtctatgctgctggaaaggctgaagtgattctggggagcatcatcaagaagaaaggctggaggaggtccagtctggtcataacaaccaaactctactggggtggaaaagctgaaacagaaagagggctgtcaagaaagcatattattgaaggattgaagggctccctccagaggctgcagctcgagtatgtggatgtggtctttgcaaatcgaccggacagtaacactcccatggaagaaattgtccgagccatgacacatgtgataaaccaaggcatggcgatgtactggggcacctcgagatggagtgctatggagatcatggaagcctattctgtagcaagacagttcaatatgatcccaccggtctgtgaacaagctgagtaccatcttttccagagagagaaagtggaggtccagctgccagagctctaccacaaaataggtgttggcgcaatgacatggtctccacttgcctgtggaatcatctcaggaaaatacggaaacggggtgcctgaaagttccagggcttcactgaagtgctaccagtggttgaaagaaagaattgtaagtgaagaagggagaaaacagcaaaacaagctaaaagacctttccccaattgcggagcgtctgggatgcacactacctcagctagctgttgcgtggtgcctgagaaacgaaggtgtgagttctgtgctcctgggatcatccactcctgaacaactcattgaaaaccttggtgccattcaggttctcccaaagatgacatcacatgtggtaaatgagattgataacatactgcgcaacaagccctacagcaagaaggactatagatcataa
Sequence Length
1206
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,492 Da
NCBI Official Full Name
Homo sapiens potassium voltage-gated channel, shaker-related subfamily, beta member 1, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily A member regulatory beta subunit 1
NCBI Official Symbol
KCNAB1
NCBI Official Synonym Symbols
hKvb3; AKR6A3; KCNA1B; Kvb1.3; hKvBeta3; KV-BETA-1
NCBI Protein Information
voltage-gated potassium channel subunit beta-1
UniProt Protein Name
Voltage-gated potassium channel subunit beta-1
UniProt Gene Name
KCNAB1
UniProt Synonym Gene Names
KCNA1B
UniProt Entry Name
KCAB1_HUMAN

NCBI Description

Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]

Uniprot Description

Kv-beta1: Accessory potassium channel protein which modulates the activity of the pore-forming alpha subunit. All three isoforms alter the functional properties of Kv1.4 and Kv1.5. Isoform KvB1.2 has no effect on Kv1.1, Kv1.2 or Kv2.1. Belongs to the shaker potassium channel beta subunit family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Channel, potassium

Chromosomal Location of Human Ortholog: 3q26.1

Cellular Component: cytosol; extrinsic to internal side of plasma membrane; plasma membrane

Molecular Function: aldo-keto reductase activity; potassium channel regulator activity

Biological Process: potassium ion transport

Research Articles on KCNAB1

Similar Products

Product Notes

The KCNAB1 kcnab1 (Catalog #AAA1274059) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaagtct ccatagcctg cacagagcac aatttgaaga gtcggaatgg tgaggaccga cttctgagca agcagagctc caccgccccc aatgtggtaa acgcagcccg ggccaaattc cgcacggtcg ctatcatcgc gcgcagcctg gggacgttca cgcctcagca tcacatttct ctcaaagagt ccaccgcaaa gcagactggc atgaaatata ggaatcttgg aaaatcagga ctcagagttt cttgcttggg tcttggaaca tgggtgacat ttggaggtca aatttcagat gaggttgctg aacggctgat gaccatcgcc tatgaaagtg gtgttaacct ctttgatact gccgaagtct atgctgctgg aaaggctgaa gtgattctgg ggagcatcat caagaagaaa ggctggagga ggtccagtct ggtcataaca accaaactct actggggtgg aaaagctgaa acagaaagag ggctgtcaag aaagcatatt attgaaggat tgaagggctc cctccagagg ctgcagctcg agtatgtgga tgtggtcttt gcaaatcgac cggacagtaa cactcccatg gaagaaattg tccgagccat gacacatgtg ataaaccaag gcatggcgat gtactggggc acctcgagat ggagtgctat ggagatcatg gaagcctatt ctgtagcaag acagttcaat atgatcccac cggtctgtga acaagctgag taccatcttt tccagagaga gaaagtggag gtccagctgc cagagctcta ccacaaaata ggtgttggcg caatgacatg gtctccactt gcctgtggaa tcatctcagg aaaatacgga aacggggtgc ctgaaagttc cagggcttca ctgaagtgct accagtggtt gaaagaaaga attgtaagtg aagaagggag aaaacagcaa aacaagctaa aagacctttc cccaattgcg gagcgtctgg gatgcacact acctcagcta gctgttgcgt ggtgcctgag aaacgaaggt gtgagttctg tgctcctggg atcatccact cctgaacaac tcattgaaaa ccttggtgcc attcaggttc tcccaaagat gacatcacat gtggtaaatg agattgataa catactgcgc aacaagccct acagcaagaa ggactataga tcataa. It is sometimes possible for the material contained within the vial of "KCNAB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.