Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNA6 cdna clone

KCNA6 cDNA Clone

Gene Names
KCNA6; HBK2; KV1.6; PPP1R96
Synonyms
KCNA6; KCNA6 cDNA Clone; KCNA6 cdna clone
Ordering
For Research Use Only!
Sequence
atgagatcggagaaatcccttacgctggcggcgccgggggaggtccgtgggccggagggagagcaacaggatgcgggagacttcccggaggccggcgggggcgggggctgctgtagtagcgagcggctggtgatcaatatctccgggctgcgctttgagacacaattgcgcaccctgtcgctgtttccggacacgctgctcggagaccctggccggcgagtccgcttcttcgaccccctgaggaacgagtacttcttcgaccgcaaccggcccagcttcgacgccatcctctactactaccagtctgggggccgcctgcggaggccggtcaacgtgcccctggacattttcctggaggagatccgcttctaccagctgggggacgaggccctggcggccttccgggaggacgagggctgcctgcccgaaggtggcgaggacgagaagccgctgccctcccagcccttccagcgccaggtgtggctgctctttgagtacccagagagctctgggccggccaggggcatcgccatcgtctccgtgttggtcattctcatctccatagtcatcttttgcctggagaccttaccccagttccgtgtagatggtcgaggtggaaacaatggtggtgtgagtcgagtctccccagtttccagggggagtcaggaggaagaggaggatgaagacgattcctacacatttcatcatggcatcacccctggggaaatggggaccgggggctcctcctcactcagtactcttgggggctccttctttacagaccccttctttctggtggagacgctgtgcattgtctggttcacttttgagctcctggtgcgcttctccgcctgccctagcaagccggccttcttccggaacatcatgaacatcattgacttggtggctatcttcccctacttcatcaccctgggcactgagctggtgcagcagcaggagcagcaaccagccagtggaggaggcggccagaatgggcagcaggccatgtccctggccatcctccgagtcatccgcctggtccgggtgttccgcatcttcaagctctcccgccactccaaggggctgcagatcctgggcaagaccttgcaggcctccatgagggagctggggctgctcatcttcttcctcttcatcggggtcatcctcttctccagtgccgtctacttcgcagaggctgacgatgacgattcgctttttcccagcatcccggatgccttctggtgggcagtggttacaatgaccacggtaggttacggggacatgtaccccatgactgtggggggaaagatcgtgggctcgctgtgtgccatcgctggggtcctcaccattgccctgcctgtgcccgtcatcgtctccaacttcaactacttctaccaccgggagacggagcaggaggagcaaggccagtatacccacgtcacttgtgggcagcctgcgccggacctgagggcaactgacaacggacttggcaagcctgacttccccgaggctaaccgggaacggagacccagctaccttcctacaccacatcgggcctatgcagagaaaagaatgctcacggaggtctga
Sequence Length
1590
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,729 Da
NCBI Official Full Name
Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 6, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily A member 6
NCBI Official Symbol
KCNA6
NCBI Official Synonym Symbols
HBK2; KV1.6; PPP1R96
NCBI Protein Information
potassium voltage-gated channel subfamily A member 6
UniProt Protein Name
Potassium voltage-gated channel subfamily A member 6
UniProt Gene Name
KCNA6
UniProt Entry Name
KCNA6_HUMAN

NCBI Description

Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class. The coding region of this gene is intronless, and the gene is clustered with genes KCNA1 and KCNA5 on chromosome 12. [provided by RefSeq, Jul 2008]

Uniprot Description

Kv1.6: Mediates the voltage-dependent potassium ion permeability of excitable membranes. Assuming opened or closed conformations in response to the voltage difference across the membrane, the protein forms a potassium-selective channel through which potassium ions may pass in accordance with their electrochemical gradient. Belongs to the potassium channel family. A (Shaker) (TC 1.A.1.2) subfamily. Kv1.6/KCNA6 sub-subfamily.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 12p13

Cellular Component: integral to plasma membrane; plasma membrane; voltage-gated potassium channel complex

Molecular Function: delayed rectifier potassium channel activity; voltage-gated potassium channel activity

Biological Process: potassium ion transport

Research Articles on KCNA6

Similar Products

Product Notes

The KCNA6 kcna6 (Catalog #AAA1266227) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagatcgg agaaatccct tacgctggcg gcgccggggg aggtccgtgg gccggaggga gagcaacagg atgcgggaga cttcccggag gccggcgggg gcgggggctg ctgtagtagc gagcggctgg tgatcaatat ctccgggctg cgctttgaga cacaattgcg caccctgtcg ctgtttccgg acacgctgct cggagaccct ggccggcgag tccgcttctt cgaccccctg aggaacgagt acttcttcga ccgcaaccgg cccagcttcg acgccatcct ctactactac cagtctgggg gccgcctgcg gaggccggtc aacgtgcccc tggacatttt cctggaggag atccgcttct accagctggg ggacgaggcc ctggcggcct tccgggagga cgagggctgc ctgcccgaag gtggcgagga cgagaagccg ctgccctccc agcccttcca gcgccaggtg tggctgctct ttgagtaccc agagagctct gggccggcca ggggcatcgc catcgtctcc gtgttggtca ttctcatctc catagtcatc ttttgcctgg agaccttacc ccagttccgt gtagatggtc gaggtggaaa caatggtggt gtgagtcgag tctccccagt ttccaggggg agtcaggagg aagaggagga tgaagacgat tcctacacat ttcatcatgg catcacccct ggggaaatgg ggaccggggg ctcctcctca ctcagtactc ttgggggctc cttctttaca gaccccttct ttctggtgga gacgctgtgc attgtctggt tcacttttga gctcctggtg cgcttctccg cctgccctag caagccggcc ttcttccgga acatcatgaa catcattgac ttggtggcta tcttccccta cttcatcacc ctgggcactg agctggtgca gcagcaggag cagcaaccag ccagtggagg aggcggccag aatgggcagc aggccatgtc cctggccatc ctccgagtca tccgcctggt ccgggtgttc cgcatcttca agctctcccg ccactccaag gggctgcaga tcctgggcaa gaccttgcag gcctccatga gggagctggg gctgctcatc ttcttcctct tcatcggggt catcctcttc tccagtgccg tctacttcgc agaggctgac gatgacgatt cgctttttcc cagcatcccg gatgccttct ggtgggcagt ggttacaatg accacggtag gttacgggga catgtacccc atgactgtgg ggggaaagat cgtgggctcg ctgtgtgcca tcgctggggt cctcaccatt gccctgcctg tgcccgtcat cgtctccaac ttcaactact tctaccaccg ggagacggag caggaggagc aaggccagta tacccacgtc acttgtgggc agcctgcgcc ggacctgagg gcaactgaca acggacttgg caagcctgac ttccccgagg ctaaccggga acggagaccc agctaccttc ctacaccaca tcgggcctat gcagagaaaa gaatgctcac ggaggtctga. It is sometimes possible for the material contained within the vial of "KCNA6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.