Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNA3 cdna clone

KCNA3 cDNA Clone

Gene Names
KCNA3; MK3; HGK5; HLK3; PCN3; HPCN3; KV1.3; HUKIII
Synonyms
KCNA3; KCNA3 cDNA Clone; KCNA3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccgtggtgcccggggaccacctgctggagccggaggtggccgatggtggaggggccccgcctcaaggcggctgtggcggcggcggctgcgaccgctacgagccgctgccgccctcactgccggccgcgggcgagcaggactgctgcggggagcgcgtggtcatcaacatctccgggctgcgcttcgagacgcagctgaagaccctttgccagttccccgagacgctgctgggcgaccccaagcggcgcatgaggtacttcgacccgctccgcaacgagtacttcttcgaccgcaaccggcccagcttcgacgccatcctctactactatcagtccgggggccgcatccgccggccggtcaacgtgcccatcgacattttctccgaggagatccgcttctaccagctgggcgaggaggccatggagaagttccgcgaggacgagggcttcctgcgggaggaggagcggcccttgccccgccgcgacttccagcgccaggtgtggctgctcttcgagtaccccgagagctccgggccggcccggggcatcgccatcgtgtccgtgctggtcatcctcatctccattgtcatcttctgcctggagacgctgccggagttccgcgacgagaaggactaccccgcctcgacgtcgcaggactcattcgaagcagccggcaacagcacgtcggggtcccgcgcaggagcctccagcttctccgatcccttcttcgtggtggagacgctgtgcatcatctggttctccttcgaactgctggtgcggttcttcgcttgtcctagcaaagccaccttctcgcgaaacatcatgaacctgatcgacattgtggccatcattccttattttatcactctgggtacagagctggccgaacgacagggcaatggacagcaggccatgtctctggccatcctgagggtcatccgcctggtaagggtcttccgcatcttcaagctgtcgcgccactccaaggggctgcagatcctcgggcaaacgctgaaggcgtccatgcgggagctgggattgctcatcttcttcctctttattggggtcatccttttctccagcgcggtctactttgccgaggcagacgaccccacttcaggtttcagcagcatcccggatgccttctggtgggcagtggtaaccatgacaacagtgggttacggcgatatgcacccagtgaccatagggggcaagattgtgggatctctctgtgccatcgccggtgtcttgaccatcgcattgccagttcccgtgattgtttccaacttcaattacttctaccaccgggagacagaaggggaagagcaatcccagtacatgcacgtgggaagttgccagcacctctcctcttcagccgaggagctccgaaaagcaaggagtaactcgactctgagtaagtcggagtatatggtgatcgaagaggggggtatgaaccatagcgctttcccccagacccctttcaaaacgggcaattccactgccacctgcaccacgaacaataatcccaactcttgtgtcaacatcaaaaagatattcaccgatgtttaa
Sequence Length
1572
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,842 Da
NCBI Official Full Name
Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 3, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily A member 3
NCBI Official Symbol
KCNA3
NCBI Official Synonym Symbols
MK3; HGK5; HLK3; PCN3; HPCN3; KV1.3; HUKIII
NCBI Protein Information
potassium voltage-gated channel subfamily A member 3
UniProt Protein Name
Potassium voltage-gated channel subfamily A member 3
UniProt Gene Name
KCNA3
UniProt Synonym Gene Names
HGK5
UniProt Entry Name
KCNA3_HUMAN

NCBI Description

Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]

Uniprot Description

Kv1.3: Mediates the voltage-dependent potassium ion permeability of excitable membranes. Assuming opened or closed conformations in response to the voltage difference across the membrane, the protein forms a potassium-selective channel through which potassium ions may pass in accordance with their electrochemical gradient. Belongs to the potassium channel family. A (Shaker) (TC 1.A.1.2) subfamily. Kv1.3/KCNA3 sub-subfamily.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Channel, potassium

Chromosomal Location of Human Ortholog: 1p13.3

Cellular Component: plasma membrane

Molecular Function: delayed rectifier potassium channel activity; voltage-gated ion channel activity

Biological Process: potassium ion transport

Research Articles on KCNA3

Similar Products

Product Notes

The KCNA3 kcna3 (Catalog #AAA1272924) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgtgg tgcccgggga ccacctgctg gagccggagg tggccgatgg tggaggggcc ccgcctcaag gcggctgtgg cggcggcggc tgcgaccgct acgagccgct gccgccctca ctgccggccg cgggcgagca ggactgctgc ggggagcgcg tggtcatcaa catctccggg ctgcgcttcg agacgcagct gaagaccctt tgccagttcc ccgagacgct gctgggcgac cccaagcggc gcatgaggta cttcgacccg ctccgcaacg agtacttctt cgaccgcaac cggcccagct tcgacgccat cctctactac tatcagtccg ggggccgcat ccgccggccg gtcaacgtgc ccatcgacat tttctccgag gagatccgct tctaccagct gggcgaggag gccatggaga agttccgcga ggacgagggc ttcctgcggg aggaggagcg gcccttgccc cgccgcgact tccagcgcca ggtgtggctg ctcttcgagt accccgagag ctccgggccg gcccggggca tcgccatcgt gtccgtgctg gtcatcctca tctccattgt catcttctgc ctggagacgc tgccggagtt ccgcgacgag aaggactacc ccgcctcgac gtcgcaggac tcattcgaag cagccggcaa cagcacgtcg gggtcccgcg caggagcctc cagcttctcc gatcccttct tcgtggtgga gacgctgtgc atcatctggt tctccttcga actgctggtg cggttcttcg cttgtcctag caaagccacc ttctcgcgaa acatcatgaa cctgatcgac attgtggcca tcattcctta ttttatcact ctgggtacag agctggccga acgacagggc aatggacagc aggccatgtc tctggccatc ctgagggtca tccgcctggt aagggtcttc cgcatcttca agctgtcgcg ccactccaag gggctgcaga tcctcgggca aacgctgaag gcgtccatgc gggagctggg attgctcatc ttcttcctct ttattggggt catccttttc tccagcgcgg tctactttgc cgaggcagac gaccccactt caggtttcag cagcatcccg gatgccttct ggtgggcagt ggtaaccatg acaacagtgg gttacggcga tatgcaccca gtgaccatag ggggcaagat tgtgggatct ctctgtgcca tcgccggtgt cttgaccatc gcattgccag ttcccgtgat tgtttccaac ttcaattact tctaccaccg ggagacagaa ggggaagagc aatcccagta catgcacgtg ggaagttgcc agcacctctc ctcttcagcc gaggagctcc gaaaagcaag gagtaactcg actctgagta agtcggagta tatggtgatc gaagaggggg gtatgaacca tagcgctttc ccccagaccc ctttcaaaac gggcaattcc actgccacct gcaccacgaa caataatccc aactcttgtg tcaacatcaa aaagatattc accgatgttt aa. It is sometimes possible for the material contained within the vial of "KCNA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.