ISG20L2 cdna clone

ISG20L2 cDNA Clone

Gene Names

ISG20L2; HSD38

Synonyms

ISG20L2; ISG20L2 cDNA Clone; ISG20L2 cdna clone

Ordering
Cat. Num. AAA1267473 For Research Use Only!

Sequence

atgtctactttactgctcaatctggattttggggaacctcctcccaaaaaggcattagaaggaaatgccaagcaccgaaattttgtcaagaagcggaggctcttagaacggagaggctttctgagtaaaaagaaccaaccccctagcaaggcgcctaagttgcactctgaaccttcaaagaaaggggaaactcctacggtcgatggcacttggaagaccccttccttcccaaaaaagaagacagctgcttccagcaatgggtcaggacagcccctggacaagaaagctgcagtgtcttggttgacccctgccccttcaaaaaaggctgattctgttgctgctaaagtagatttgctgggggagttccagagtgcccttccaaagatcaatagccacccaacccgctctcagaagaagagctcccagaagaaatcctctaaaaagaaccatcctcagaagaatgccccacagaactccacccaagctcattcagagaataaatgctccggagcatcccagaagttgccacggaagatggtggcaattgactgtgagatggtgggcacaggaccaaaggggcatgttagttccttggctcgatgtagcattgtcaactacaacggagatgtgctttatgacgagtacattcttcccccctgccacattgtggactaccgaaccaggtggagtggtatccggaagcagcacatggtgaatgccacacccttcaagattgctcgaggccagatcttgaagatactcacagggaagatagtggtggggcatgccatccacaacgacttcaaagcccttcagtactttcaccccaagtccctcacccgtgacacctcccatatcccccccctcaaccggaaggctgactgcccggagaatgccaccatgtctctgaagcatctcaccaagaagctgctaaaccgggatatccaggttgggaagagcggacattcctctgtggaagatgcccaggccaccatggagctatataagttggttgaagtcgagtgggaagagcacctagcccggaatccccctacagactag

Sequence Length

1062

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

33875599

NCBI GeneID

81875

Molecular Weight

39,154 Da

NCBI Official Full Name

Homo sapiens interferon stimulated exonuclease gene 20kDa-like 2, mRNA

NCBI Official Synonym Full Names

interferon stimulated exonuclease gene 20 like 2

NCBI Official Symbol

ISG20L2

NCBI Official Synonym Symbols

HSD38

NCBI Protein Information

interferon-stimulated 20 kDa exonuclease-like 2

UniProt Protein Name

Interferon-stimulated 20 kDa exonuclease-like 2

Protein Family

Interferon-stimulated 20 kDa exonuclease

UniProt Gene Name

ISG20L2

UniProt Entry Name

I20L2_HUMAN

NCBI Description

This gene encodes a 3'-5' exoribonuclease that may be involved in the processing of the 12S pre-rRNA. Pseudogenes have been identified on chromosomes 6 and 11. [provided by RefSeq, Dec 2014]

Uniprot Description

ISG20L2: 3'-> 5'-exoribonuclease involved in ribosome biogenesis in the processing of the 12S pre-rRNA. Displays a strong specificity for a 3'-end containing a free hydroxyl group.

Protein type: Hydrolase; EC 3.1.-.-; Nucleolus

Chromosomal Location of Human Ortholog: 1q23.1

Cellular Component: nucleoplasm

Molecular Function: 3'-5'-exoribonuclease activity; protein binding

Biological Process: rRNA processing

Research Articles on ISG20L2

1. ISG20L2 is a 3' to 5' exoribonuclease involved in ribosome biogenesis at the level of 5.8 S rRNA maturation, more specifically in the processing of the 12 S precursor rRNA.

Similar Products

Product Notes

The ISG20L2 isg20l2 (Catalog #AAA1267473) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctactt tactgctcaa tctggatttt ggggaacctc ctcccaaaaa ggcattagaa ggaaatgcca agcaccgaaa ttttgtcaag aagcggaggc tcttagaacg gagaggcttt ctgagtaaaa agaaccaacc ccctagcaag gcgcctaagt tgcactctga accttcaaag aaaggggaaa ctcctacggt cgatggcact tggaagaccc cttccttccc aaaaaagaag acagctgctt ccagcaatgg gtcaggacag cccctggaca agaaagctgc agtgtcttgg ttgacccctg ccccttcaaa aaaggctgat tctgttgctg ctaaagtaga tttgctgggg gagttccaga gtgcccttcc aaagatcaat agccacccaa cccgctctca gaagaagagc tcccagaaga aatcctctaa aaagaaccat cctcagaaga atgccccaca gaactccacc caagctcatt cagagaataa atgctccgga gcatcccaga agttgccacg gaagatggtg gcaattgact gtgagatggt gggcacagga ccaaaggggc atgttagttc cttggctcga tgtagcattg tcaactacaa cggagatgtg ctttatgacg agtacattct tcccccctgc cacattgtgg actaccgaac caggtggagt ggtatccgga agcagcacat ggtgaatgcc acacccttca agattgctcg aggccagatc ttgaagatac tcacagggaa gatagtggtg gggcatgcca tccacaacga cttcaaagcc cttcagtact ttcaccccaa gtccctcacc cgtgacacct cccatatccc ccccctcaac cggaaggctg actgcccgga gaatgccacc atgtctctga agcatctcac caagaagctg ctaaaccggg atatccaggt tgggaagagc ggacattcct ctgtggaaga tgcccaggcc accatggagc tatataagtt ggttgaagtc gagtgggaag agcacctagc ccggaatccc cctacagact ag. It is sometimes possible for the material contained within the vial of "ISG20L2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ISG20L2 cdna clone