Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ISG20 cdna clone

ISG20 cDNA Clone

Gene Names
ISG20; CD25; HEM45
Synonyms
ISG20; ISG20 cDNA Clone; ISG20 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgggagccgtgaggtggtggccatggactgcgagatggtggggctggggccccaccgggagagtggcctggctcgttgcagcctcgtgaacgtccacggtgctgtgctgtacgacaagttcatccggcctgagggagagatcaccgattacagaacccgggtcagcggggtcacccctcagcacatggtgggggccacaccatttgccgtggccaggctagagatcctgcagctcctgaaaggcaagctggtggtgggtcatgacctgaagcacgacttccaggcactgaaagaggacatgagcggctacacaatctacgacacgtccactgacaggctgttgtggcgtgaggccaagctggaccactgcaggcgtgtctccctgcgggtgctgagtgagcgcctcctgcacaagagcatccagaacagcctgcttggacacagctcggtggaagatgcgagggcaacgatggagctctatcaaatctcccagagaatccgagcccgccgagggctgccccgcctggctgtgtcagactga
Sequence Length
546
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,199 Da
NCBI Official Full Name
Homo sapiens interferon stimulated exonuclease gene 20kDa, mRNA
NCBI Official Synonym Full Names
interferon stimulated exonuclease gene 20
NCBI Official Symbol
ISG20
NCBI Official Synonym Symbols
CD25; HEM45
NCBI Protein Information
interferon-stimulated gene 20 kDa protein
UniProt Protein Name
Interferon-stimulated gene 20 kDa protein
UniProt Gene Name
ISG20
UniProt Synonym Gene Names
HEM45
UniProt Entry Name
ISG20_HUMAN

Uniprot Description

ISG20: Exonuclease with specificity for single-stranded RNA and, to a lesser extent for DNA. Degrades RNA at a rate that is approximately 35-fold higher than its rate for single-stranded DNA. Involved in the antiviral function of IFN against RNA viruses. Belongs to the exonuclease superfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.1.13.1; Ribonuclease; Nucleolus; Deoxyribonuclease

Chromosomal Location of Human Ortholog: 15q26

Cellular Component: Cajal body; cytoplasm; nucleolus; nucleoplasm; nucleus; PML body

Molecular Function: 3'-5'-exoribonuclease activity; exonuclease activity; single-stranded DNA specific 3'-5' exodeoxyribonuclease activity; U1 snRNA binding; U2 snRNA binding

Biological Process: cell proliferation; defense response to virus; DNA catabolic process, exonucleolytic; negative regulation of viral genome replication; response to virus; RNA catabolic process

Research Articles on ISG20

Similar Products

Product Notes

The ISG20 isg20 (Catalog #AAA1266565) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctggga gccgtgaggt ggtggccatg gactgcgaga tggtggggct ggggccccac cgggagagtg gcctggctcg ttgcagcctc gtgaacgtcc acggtgctgt gctgtacgac aagttcatcc ggcctgaggg agagatcacc gattacagaa cccgggtcag cggggtcacc cctcagcaca tggtgggggc cacaccattt gccgtggcca ggctagagat cctgcagctc ctgaaaggca agctggtggt gggtcatgac ctgaagcacg acttccaggc actgaaagag gacatgagcg gctacacaat ctacgacacg tccactgaca ggctgttgtg gcgtgaggcc aagctggacc actgcaggcg tgtctccctg cgggtgctga gtgagcgcct cctgcacaag agcatccaga acagcctgct tggacacagc tcggtggaag atgcgagggc aacgatggag ctctatcaaa tctcccagag aatccgagcc cgccgagggc tgccccgcct ggctgtgtca gactga. It is sometimes possible for the material contained within the vial of "ISG20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.