Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IDH3B cdna clone

IDH3B cDNA Clone

Gene Names
IDH3B; RP46
Synonyms
IDH3B; IDH3B cDNA Clone; IDH3B cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcattgagcggagtccgctggctgacccgagcgctggtctccgccgggaaccctggggcatggagaggtctgagtacctcggccgcggcgcacgctgcatcgcggagccaggccgaggacgtgagggtggagggctcctttcccgtgaccatgcttccgggagacggtgtggggcctgagctgatgcacgccgtcaaggaggtgttcaaggctgccgctgtcccagtggagttccaggagcaccacctgagtgaggtgcagaatatggcatctgaggagaagctggagcaggtgctgagttccatgaaggagaacaaagtggccatcattggaaagattcataccccgatggagtataagggggagctagcctcctatgatatgcggctgaggcgtaagttggacttatttgccaacgtagtccatgtgaagtcacttcctgggtatatgactcggcacaacaatctagacctggtgatcattcgagagcagacagaaggggagtacagctctctggaacatgagagtgcaaggggtgtgattgagtgtttgaagattgtcacacgagccaagtctcagcggattgcaaagttcgcctttgactatgccaccaagaaggggcggggcaaggtcactgctgtccacaaggccaacatcatgaaacttggggatgggttgttcctgcagtgctgtgaggaagttgctgaactgtaccccaaaatcaaatttgagacaatgatcatagacaactgctgcatgcagctggtgcagaatccttaccagtttgatgtgcttgtgatgcccaatctctatgggaacattattgacaatctggctgctggcctggttgggggagctggtgtggtccctggtgagagctatagtgcagaatacgcagtctttgagacgggtgcccggcacccatttgcccaggcagtgggcaggaatatagccaatcccacggccatgctgctgtcggcttccaacatgctgcggcatcttaatcttgagtatcactccagcatgatcgcagatgcggtgaagaaggtgatcaaagttggcaaggtgcggactcgagacatgggcggctacagcaccacaaccgacttcatcaagtctgtcatcggtcacctgcagactaaagggagctag
Sequence Length
1158
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,555 Da
NCBI Official Full Name
Homo sapiens isocitrate dehydrogenase 3 (NAD+) beta, mRNA
NCBI Official Synonym Full Names
isocitrate dehydrogenase 3 (NAD(+)) beta
NCBI Official Symbol
IDH3B
NCBI Official Synonym Symbols
RP46
NCBI Protein Information
isocitrate dehydrogenase [NAD] subunit beta, mitochondrial
UniProt Protein Name
Isocitrate dehydrogenase [NAD] subunit beta, mitochondrial
Protein Family
UniProt Gene Name
IDH3B
UniProt Entry Name
IDH3B_HUMAN

NCBI Description

Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Three alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

IDH3B: a enzyme that that catalyzes the oxidative decarboxylation of isocitrate to alpha-ketoglutarate (alpha-KG), requiring nicotinamide adenine dinucleotide (NAD) as a cofactor. The holoenzyme is a heterooligomer of subunits alpha, beta, and gamma in the apparent ratio of 2:1:1. IDH3 is a mitochondrial enzyme that functions in the Krebs cycle, which generates substrates for cellular respiration. Alpha-KG can exit the mitochondria and enter other cellular compartments where it is a cofactor for the dioxygenases that hydroxylate the transcription factor HIF and trigger its degradation by VHL. Since HIF turns on oncogenic pathways, IDH3 has apparent tumor suppressor activity. Two isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - citrate (TCA) cycle; EC 1.1.1.41; Oxidoreductase; Mitochondrial

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: mitochondrial matrix; mitochondrion; nucleus

Molecular Function: electron carrier activity

Biological Process: tricarboxylic acid cycle

Disease: Retinitis Pigmentosa 46

Research Articles on IDH3B

Similar Products

Product Notes

The IDH3B idh3b (Catalog #AAA1271190) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcat tgagcggagt ccgctggctg acccgagcgc tggtctccgc cgggaaccct ggggcatgga gaggtctgag tacctcggcc gcggcgcacg ctgcatcgcg gagccaggcc gaggacgtga gggtggaggg ctcctttccc gtgaccatgc ttccgggaga cggtgtgggg cctgagctga tgcacgccgt caaggaggtg ttcaaggctg ccgctgtccc agtggagttc caggagcacc acctgagtga ggtgcagaat atggcatctg aggagaagct ggagcaggtg ctgagttcca tgaaggagaa caaagtggcc atcattggaa agattcatac cccgatggag tataaggggg agctagcctc ctatgatatg cggctgaggc gtaagttgga cttatttgcc aacgtagtcc atgtgaagtc acttcctggg tatatgactc ggcacaacaa tctagacctg gtgatcattc gagagcagac agaaggggag tacagctctc tggaacatga gagtgcaagg ggtgtgattg agtgtttgaa gattgtcaca cgagccaagt ctcagcggat tgcaaagttc gcctttgact atgccaccaa gaaggggcgg ggcaaggtca ctgctgtcca caaggccaac atcatgaaac ttggggatgg gttgttcctg cagtgctgtg aggaagttgc tgaactgtac cccaaaatca aatttgagac aatgatcata gacaactgct gcatgcagct ggtgcagaat ccttaccagt ttgatgtgct tgtgatgccc aatctctatg ggaacattat tgacaatctg gctgctggcc tggttggggg agctggtgtg gtccctggtg agagctatag tgcagaatac gcagtctttg agacgggtgc ccggcaccca tttgcccagg cagtgggcag gaatatagcc aatcccacgg ccatgctgct gtcggcttcc aacatgctgc ggcatcttaa tcttgagtat cactccagca tgatcgcaga tgcggtgaag aaggtgatca aagttggcaa ggtgcggact cgagacatgg gcggctacag caccacaacc gacttcatca agtctgtcat cggtcacctg cagactaaag ggagctag. It is sometimes possible for the material contained within the vial of "IDH3B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.