Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HYI cdna clone

HYI cDNA Clone

Gene Names
HYI; HT036
Synonyms
HYI; HYI cDNA Clone; HYI cdna clone
Ordering
For Research Use Only!
Sequence
atggggctgggggccgtccccgggagacaggcggccttccgagagggactggagcaggccgtgcggtatgccaaagccctgggctgtcccaggatccacctgatggctggccgagtaccccagggagctgatcgaatagcagtcaaggctgagatggaggccgtttttctggagaacctgaggcatgcagctggggttttggctcaggaggacctcgtgggactgctggagcccatcaacacccgcatcactgatccccagtacttcctggacacgccccagcaggcggcagccatcttacagaaggtaggaagacccaacctccaattacaaatggacatattccactggcagatcatggatgggaacctgacaggaaacatccgggagttcctgcccattgttgggcatgtgcaggtggcacaggtcccaggccgaggggagcccagcagccccggagagctgaatttcccctatctgtttcaactgctggaagatgaaggctacaaaggcttcgtgggctga
Sequence Length
525
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,616 Da
NCBI Official Full Name
Homo sapiens hydroxypyruvate isomerase homolog (E. coli), mRNA
NCBI Official Synonym Full Names
hydroxypyruvate isomerase (putative)
NCBI Official Symbol
HYI
NCBI Official Synonym Symbols
HT036
NCBI Protein Information
putative hydroxypyruvate isomerase
UniProt Protein Name
Putative hydroxypyruvate isomerase
Protein Family
UniProt Gene Name
HYI
UniProt Entry Name
HYI_HUMAN

NCBI Description

This gene encodes a putative hydroxypyruvate isomerase, which likely catalyzes the conversion of hydroxypyruvate to 2-hydroxy-3-oxopropanoate, and may be involved in carbohydrate transport and metabolism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Uniprot Description

HYI: a putative hydroxypyruvate isomerase, which likely catalyzes the conversion of hydroxypyruvate to 2-hydroxy-3-oxopropanoate, and may be involved in carbohydrate transport and metabolism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Protein type: Isomerase; Carbohydrate Metabolism - glyoxylate and dicarboxylate; EC 5.3.1.22

Chromosomal Location of Human Ortholog: 1p34.2

Molecular Function: protein binding

Research Articles on HYI

Similar Products

Product Notes

The HYI hyi (Catalog #AAA1272153) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggctgg gggccgtccc cgggagacag gcggccttcc gagagggact ggagcaggcc gtgcggtatg ccaaagccct gggctgtccc aggatccacc tgatggctgg ccgagtaccc cagggagctg atcgaatagc agtcaaggct gagatggagg ccgtttttct ggagaacctg aggcatgcag ctggggtttt ggctcaggag gacctcgtgg gactgctgga gcccatcaac acccgcatca ctgatcccca gtacttcctg gacacgcccc agcaggcggc agccatctta cagaaggtag gaagacccaa cctccaatta caaatggaca tattccactg gcagatcatg gatgggaacc tgacaggaaa catccgggag ttcctgccca ttgttgggca tgtgcaggtg gcacaggtcc caggccgagg ggagcccagc agccccggag agctgaattt cccctatctg tttcaactgc tggaagatga aggctacaaa ggcttcgtgg gctga. It is sometimes possible for the material contained within the vial of "HYI, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.