Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GC cdna clone

GC cDNA Clone

Gene Names
GC; DBP; GRD3; VDBG; VDBP; GcMAF; DBP/GC; Gc-MAF; HEL-S-51
Synonyms
GC; GC cDNA Clone; GC cdna clone
Ordering
For Research Use Only!
Sequence
atgaagagggtcctggtactactgcttgctgtggcatttggacatgctttagagagaggccgggattatgaaaagaataaagtctgcaaggaattctcccatctgggaaaggaggacttcacatctctgtcactagtcctgtacagtagaaaatttcccagtggcacgtttgaacaggtcagccaacttgtgaaggaagttgtctccttgaccgaagcctgctgtgcggaaggggctgaccctgactgctatgacaccaggacctcagcactgtctgccaagtcctgtgaaagtaattctccattccccgttcacccaggcactgctgagtgctgcaccaaagagggcctggaacgaaagctctgcatggctgctctgaaacaccagccacaggaattccctacctacgtggaacccacaaatgatgaaatctgtgaggcgttcaggaaagatccaaaggaatatgctaatcaatttatgtgggaatattccactaattacggacaagctcctctgtcacttttagtcagttacaccaagagttatctttctatggtagggtcctgctgtacctctgcaagcccaactgtatgctttttgaaagagagactccagcttaaacatttatcacttctcaccactctgtcaaatagagtctgctcacaatatgctgcttatggggagaagaaatcaaggctcagcaatctcataaagttagcccaaaaagtgcctactgctgatctggaggatgttttgccactagctgaagatattactaacatcctctccaaatgctgtgagtctgcctctgaagattgcatggccaaagagctgcctgaacacacagtaaaactctgtgacaatttatccacaaagaattctaagtttgaagactgttgtcaagaaaaaacagccatggacgtttttgtgtgcacttacttcatgccagctgcccaactccccgagcttccagatgtagagttgcccacaaacaaagatgtgtgtgatccaggaaacaccaaagtcatggataagtatacatttgaactaagcagaaggactcatcttccggaagtattcctcagtaaggtacttgagccaaccctaaaaagccttggtgaatgctgtgatgttgaagactcaactacctgttttaatgctaagggccctctactaaagaaggaactatcttctttcattgacaagggacaagaactatgtgcagattattcagaaaatacatttactgagtacaagaaaaaactggcagagcgactaaaagcaaaattgcctgatgccacacccacggaactggcaaagctggttaacaagcgctcagactttgcctccaactgctgttccataaactcacctcctctttactgtgattcagagattgatgctgaattgaagaatatcctgtag
Sequence Length
1425
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,123 Da
NCBI Official Full Name
Homo sapiens group-specific component (vitamin D binding protein), mRNA
NCBI Official Synonym Full Names
GC, vitamin D binding protein
NCBI Official Symbol
GC
NCBI Official Synonym Symbols
DBP; GRD3; VDBG; VDBP; GcMAF; DBP/GC; Gc-MAF; HEL-S-51
NCBI Protein Information
vitamin D-binding protein
UniProt Protein Name
Vitamin D-binding protein
UniProt Gene Name
GC
UniProt Synonym Gene Names
DBP-maf
UniProt Entry Name
VTDB_HUMAN

NCBI Description

The protein encoded by this gene belongs to the albumin gene family. It is a multifunctional protein found in plasma, ascitic fluid, cerebrospinal fluid and on the surface of many cell types. It binds to vitamin D and its plasma metabolites and transports them to target tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]

Uniprot Description

GC: Multifunctional protein found in plasma, ascitic fluid, cerebrospinal fluid, and urine and on the surface of many cell types. In plasma, it carries the vitamin D sterols and prevents polymerization of actin by binding its monomers. DBP associates with membrane-bound immunoglobulin on the surface of B-lymphocytes and with IgG Fc receptor on the membranes of T-lymphocytes. Belongs to the ALB/AFP/VDB family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 4q12-q13

Cellular Component: cytosol; extracellular region; extracellular space; lysosomal lumen

Molecular Function: actin binding; vitamin D binding

Biological Process: vitamin D metabolic process

Disease: Graves Disease, Susceptibility To, 1

Research Articles on GC

Similar Products

Product Notes

The GC gc (Catalog #AAA1266850) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaggg tcctggtact actgcttgct gtggcatttg gacatgcttt agagagaggc cgggattatg aaaagaataa agtctgcaag gaattctccc atctgggaaa ggaggacttc acatctctgt cactagtcct gtacagtaga aaatttccca gtggcacgtt tgaacaggtc agccaacttg tgaaggaagt tgtctccttg accgaagcct gctgtgcgga aggggctgac cctgactgct atgacaccag gacctcagca ctgtctgcca agtcctgtga aagtaattct ccattccccg ttcacccagg cactgctgag tgctgcacca aagagggcct ggaacgaaag ctctgcatgg ctgctctgaa acaccagcca caggaattcc ctacctacgt ggaacccaca aatgatgaaa tctgtgaggc gttcaggaaa gatccaaagg aatatgctaa tcaatttatg tgggaatatt ccactaatta cggacaagct cctctgtcac ttttagtcag ttacaccaag agttatcttt ctatggtagg gtcctgctgt acctctgcaa gcccaactgt atgctttttg aaagagagac tccagcttaa acatttatca cttctcacca ctctgtcaaa tagagtctgc tcacaatatg ctgcttatgg ggagaagaaa tcaaggctca gcaatctcat aaagttagcc caaaaagtgc ctactgctga tctggaggat gttttgccac tagctgaaga tattactaac atcctctcca aatgctgtga gtctgcctct gaagattgca tggccaaaga gctgcctgaa cacacagtaa aactctgtga caatttatcc acaaagaatt ctaagtttga agactgttgt caagaaaaaa cagccatgga cgtttttgtg tgcacttact tcatgccagc tgcccaactc cccgagcttc cagatgtaga gttgcccaca aacaaagatg tgtgtgatcc aggaaacacc aaagtcatgg ataagtatac atttgaacta agcagaagga ctcatcttcc ggaagtattc ctcagtaagg tacttgagcc aaccctaaaa agccttggtg aatgctgtga tgttgaagac tcaactacct gttttaatgc taagggccct ctactaaaga aggaactatc ttctttcatt gacaagggac aagaactatg tgcagattat tcagaaaata catttactga gtacaagaaa aaactggcag agcgactaaa agcaaaattg cctgatgcca cacccacgga actggcaaag ctggttaaca agcgctcaga ctttgcctcc aactgctgtt ccataaactc acctcctctt tactgtgatt cagagattga tgctgaattg aagaatatcc tgtag. It is sometimes possible for the material contained within the vial of "GC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.