Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GABRB1 cdna clone

GABRB1 cDNA Clone

Synonyms
GABRB1; GABRB1 cDNA Clone; GABRB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggacagtacaaaatcgagagagtctggggcttctctctttccctgtgatgattaccatggtctgttgtgcacacagcaccaatgaacccagcaacatgtcatacgtgaaagagacagtggacagattgctcaaaggatatgacattcgcttgcggccggacttcggagggccccccgtcgacgttgggatgcggatcgatgtcgccagcatagacatggtctccgaagtgaatatggattatacactcaccatgtatttccagcagtcttggaaagacaaaaggctttcttattctggaatcccactgaacctcaccctagacaatagggtagctgaccaactctgtgtaccagacacctactttctgaatgacaagaaatcatttgtgcatggggtcacagtgaaaaatcgaatgattcgactgcatcctgatggaacagttctctatggactccgaatcacaaccacagctgcatgtatgatggatcttcgaagatatccactggatgagcagaactgcaccctggagatcgaaagttatggctataccactgatgacattgaattttactggaatggaggagaaggggcagtcactggtgttaataaaatcgaacttcctcaattttcaattgttgactacaagatggtgtctaagaaggtggagttcacaacaggagcgtatccacgactgtcactaagttttcgtctaaagagaaacattggttacttcattttgcaaacctacatgccttctacactgattacaattctgtcctgggtgtctttttggatcaactatgatgcatctgcagccagagtcgcactaggaatcacgacggtgcttacaatgacaaccatcagcacccacctcagggagaccctgccaaagatcccttatgtcaaagcgattgatatttatctgatgggttgctttgtgtttgtgttcctggctctgctggagtatgcctttgtaaattacatcttctttgggaaaggccctcagaaaaagggagctagcaaacaagaccagagtgccaatgagaagaataaactggagatgaataaagtccaggtcgacgcccacggtaacattctcctcagcaccctggaaatccggaatgagacgagtggctcggaagtgctcacgagcgtgagcgaccccaaggccaccatgtactcctatgacagcgccagcatccagtaccgcaagcccctgagcagccgcgaggcctacgggcgcgccctggaccggcacggggtacccagcaaggggcgcaaccgcaggcgtgcctcccagctcaaagtcaagatccccgacttgactgatgtgaattccatagacaagtggtcccgaatgtttttccccatcaccttttctctttttaatgtcgtctattggctttactatgtacactga
Sequence Length
1425
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,151 Da
NCBI Official Full Name
Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 1, mRNA
NCBI Official Synonym Full Names
gamma-aminobutyric acid type A receptor beta1 subunit
NCBI Official Symbol
GABRB1
NCBI Protein Information
gamma-aminobutyric acid receptor subunit beta-1
UniProt Protein Name
Gamma-aminobutyric acid receptor subunit beta-1
UniProt Gene Name
GABRB1
UniProt Entry Name
GBRB1_HUMAN

NCBI Description

The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]

Uniprot Description

GABRB1: GABA, the major inhibitory neurotransmitter in the vertebrate brain, mediates neuronal inhibition by binding to the GABA/benzodiazepine receptor and opening an integral chloride channel. Belongs to the ligand-gated ion channel (TC 1.A.9) family. Gamma-aminobutyric acid receptor (TC 1.A.9.5) subfamily. GABRB1 sub-subfamily.

Protein type: Membrane protein, integral; Transporter, ion channel; Membrane protein, multi-pass; Channel, ligand-gated; Transporter; Channel, chloride

Chromosomal Location of Human Ortholog: 4p12

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: GABA-A receptor activity; GABA-gated chloride ion channel activity; ligand-gated ion channel activity

Biological Process: ion transport; signal transduction; transport

Research Articles on GABRB1

Similar Products

Product Notes

The GABRB1 gabrb1 (Catalog #AAA1277683) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggacag tacaaaatcg agagagtctg gggcttctct ctttccctgt gatgattacc atggtctgtt gtgcacacag caccaatgaa cccagcaaca tgtcatacgt gaaagagaca gtggacagat tgctcaaagg atatgacatt cgcttgcggc cggacttcgg agggcccccc gtcgacgttg ggatgcggat cgatgtcgcc agcatagaca tggtctccga agtgaatatg gattatacac tcaccatgta tttccagcag tcttggaaag acaaaaggct ttcttattct ggaatcccac tgaacctcac cctagacaat agggtagctg accaactctg tgtaccagac acctactttc tgaatgacaa gaaatcattt gtgcatgggg tcacagtgaa aaatcgaatg attcgactgc atcctgatgg aacagttctc tatggactcc gaatcacaac cacagctgca tgtatgatgg atcttcgaag atatccactg gatgagcaga actgcaccct ggagatcgaa agttatggct ataccactga tgacattgaa ttttactgga atggaggaga aggggcagtc actggtgtta ataaaatcga acttcctcaa ttttcaattg ttgactacaa gatggtgtct aagaaggtgg agttcacaac aggagcgtat ccacgactgt cactaagttt tcgtctaaag agaaacattg gttacttcat tttgcaaacc tacatgcctt ctacactgat tacaattctg tcctgggtgt ctttttggat caactatgat gcatctgcag ccagagtcgc actaggaatc acgacggtgc ttacaatgac aaccatcagc acccacctca gggagaccct gccaaagatc ccttatgtca aagcgattga tatttatctg atgggttgct ttgtgtttgt gttcctggct ctgctggagt atgcctttgt aaattacatc ttctttggga aaggccctca gaaaaaggga gctagcaaac aagaccagag tgccaatgag aagaataaac tggagatgaa taaagtccag gtcgacgccc acggtaacat tctcctcagc accctggaaa tccggaatga gacgagtggc tcggaagtgc tcacgagcgt gagcgacccc aaggccacca tgtactccta tgacagcgcc agcatccagt accgcaagcc cctgagcagc cgcgaggcct acgggcgcgc cctggaccgg cacggggtac ccagcaaggg gcgcaaccgc aggcgtgcct cccagctcaa agtcaagatc cccgacttga ctgatgtgaa ttccatagac aagtggtccc gaatgttttt ccccatcacc ttttctcttt ttaatgtcgt ctattggctt tactatgtac actga. It is sometimes possible for the material contained within the vial of "GABRB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.