FAM96B cdna clone
FAM96B cDNA Clone
Gene Names
FAM96B; MIP18; CGI-128
Synonyms
FAM96B; FAM96B cDNA Clone; FAM96B cdna clone
Sequence
atggtaggcggcggcggggtcggcggcggcctcctggagaatgccaaccccctcatctaccagcgctctggggagcggcctgtgacggcaggcgaggaggacgagcaggttcccgacagcatcgacgcacgcgagatcttcgatctgattcgctccatcaatgacccggagcatccactgacgctagaggagttgaacgtagtagagcaggtgcgggttcaggttagcgaccccgagagtacagtggctgtggctttcacaccaaccattccgcactgcagcatggccacccttattggtctgtccatcaaggtcaagcttctgcgctcccttcctcagcgtttcaagatggacgtgcacattactccggggacccatgcctcagagcatgcagtgaacaagcaacttgcagataaggagcgggtggcagctgccctggagaacacccacctcttggaggttgtgaatcagtgcctgtcagcccgctcctga
Sequence Length
492
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,663 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 96, member B, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 96 member B
NCBI Official Symbol
FAM96B
NCBI Official Synonym Symbols
MIP18; CGI-128
NCBI Protein Information
mitotic spindle-associated MMXD complex subunit MIP18
UniProt Protein Name
Mitotic spindle-associated MMXD complex subunit MIP18
Protein Family
UniProt Gene Name
FAM96B
UniProt Synonym Gene Names
MIP18
UniProt Entry Name
MIP18_HUMAN
Uniprot Description
FAM96B: Component of the cytosolic iron-sulfur protein assembly (CIA) complex, a multiprotein complex that mediates the incorporation of iron-sulfur cluster into extramitochondrial Fe/S proteins. As part of the mitotic spindle-associated MMXD complex it plays a role in chromosome segregation, probably by facilitating iron-sulfur cluster assembly into ERCC2/XPD. Belongs to the MIP18 family.
Chromosomal Location of Human Ortholog: 16q22.1
Cellular Component: cytoplasm; nucleoplasm; nucleus; spindle
Molecular Function: protein binding
Biological Process: chromosome segregation; iron-sulfur cluster assembly
Research Articles on FAM96B
Similar Products
Product Notes
The FAM96B fam96b (Catalog #AAA1272036) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtaggcg gcggcggggt cggcggcggc ctcctggaga atgccaaccc cctcatctac cagcgctctg gggagcggcc tgtgacggca ggcgaggagg acgagcaggt tcccgacagc atcgacgcac gcgagatctt cgatctgatt cgctccatca atgacccgga gcatccactg acgctagagg agttgaacgt agtagagcag gtgcgggttc aggttagcga ccccgagagt acagtggctg tggctttcac accaaccatt ccgcactgca gcatggccac ccttattggt ctgtccatca aggtcaagct tctgcgctcc cttcctcagc gtttcaagat ggacgtgcac attactccgg ggacccatgc ctcagagcat gcagtgaaca agcaacttgc agataaggag cgggtggcag ctgccctgga gaacacccac ctcttggagg ttgtgaatca gtgcctgtca gcccgctcct ga. It is sometimes possible for the material contained within the vial of "FAM96B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
