Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

F8 cdna clone

F8 cDNA Clone

Gene Names
F8; AHF; F8B; F8C; HEMA; FVIII; DXS1253E
Synonyms
F8; F8 cDNA Clone; F8 cdna clone
Ordering
For Research Use Only!
Sequence
atgcggatccaagaccctgggaaggtcttctttggcaatgtggattcatctgggataaaacacaatatttttaaccctccaattattgctcgatacatccgtttgcacccaactcattatagcattcgcagcactcttcgcatggagttgatgggctgtgatttaaatagttgcagcatgccattgggaatggagagtaaagcaatatcagatgcacagattactgcttcatcctactttaccaatatgtttgccacctggtctccttcaaaagctcgacttcacctccaagggaggagtaatgcctggagacctcaggtgaataatccaaaagagtggctgcaagtggacttccagaagacaatgaaagtcacaggagtaactactcagggagtaaaatctctgcttaccagcatgtatgtgaaggagttcctcatctccagcagtcaagatggccatcagtggactctcttttttcagaatggcaaagtaaaggtttttcagggaaatcaagactccttcacacctgtggtgaactctctagacccaccgttactgactcgctaccttcgaattcacccccagagttgggtgcaccagattgccctgaggatggaggttctgggctgcgaggcacaggacctctactga
Sequence Length
651
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,641 Da
NCBI Official Full Name
Homo sapiens coagulation factor VIII, procoagulant component, mRNA
NCBI Official Synonym Full Names
coagulation factor VIII
NCBI Official Symbol
F8
NCBI Official Synonym Symbols
AHF; F8B; F8C; HEMA; FVIII; DXS1253E
NCBI Protein Information
coagulation factor VIII
UniProt Protein Name
Coagulation factor VIII
Protein Family
UniProt Gene Name
F8
UniProt Synonym Gene Names
F8C; AHF
UniProt Entry Name
FA8_HUMAN

NCBI Description

This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008]

Uniprot Description

F8: Factor VIII, along with calcium and phospholipid, acts as a cofactor for factor IXa when it converts factor X to the activated form, factor Xa. Defects in F8 are the cause of hemophilia A (HEMA). A disorder of blood coagulation characterized by a permanent tendency to hemorrhage. About 50% of patients have severe hemophilia resulting in frequent spontaneous bleeding into joints, muscles and internal organs. Less severe forms are characterized by bleeding after trauma or surgery. Of particular interest for the understanding of the function of F8 is the category of CRM (cross-reacting material) positive patients (approximately 5%) that have considerable amount of F8 in their plasma (at least 30% of normal), but the protein is non- functional; i.e. the F8 activity is much less than the plasma protein level. CRM-reduced is another category of patients in which the F8C antigen and activity are reduced to approximately the same level. Most mutations are CRM negative, and probably affect the folding and stability of the protein. Belongs to the multicopper oxidase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: endoplasmic reticulum lumen; ER to Golgi transport vesicle; ER-Golgi intermediate compartment membrane; extracellular region; plasma membrane

Molecular Function: protein binding

Biological Process: blood coagulation; blood coagulation, intrinsic pathway; COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; platelet degranulation

Disease: Factor Viii Deficiency; Hemophilia A

Research Articles on F8

Similar Products

Product Notes

The F8 f8 (Catalog #AAA1277961) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggatcc aagaccctgg gaaggtcttc tttggcaatg tggattcatc tgggataaaa cacaatattt ttaaccctcc aattattgct cgatacatcc gtttgcaccc aactcattat agcattcgca gcactcttcg catggagttg atgggctgtg atttaaatag ttgcagcatg ccattgggaa tggagagtaa agcaatatca gatgcacaga ttactgcttc atcctacttt accaatatgt ttgccacctg gtctccttca aaagctcgac ttcacctcca agggaggagt aatgcctgga gacctcaggt gaataatcca aaagagtggc tgcaagtgga cttccagaag acaatgaaag tcacaggagt aactactcag ggagtaaaat ctctgcttac cagcatgtat gtgaaggagt tcctcatctc cagcagtcaa gatggccatc agtggactct cttttttcag aatggcaaag taaaggtttt tcagggaaat caagactcct tcacacctgt ggtgaactct ctagacccac cgttactgac tcgctacctt cgaattcacc cccagagttg ggtgcaccag attgccctga ggatggaggt tctgggctgc gaggcacagg acctctactg a. It is sometimes possible for the material contained within the vial of "F8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.