Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EEF1E1 cdna clone

EEF1E1 cDNA Clone

Gene Names
EEF1E1; P18; AIMP3
Synonyms
EEF1E1; EEF1E1 cDNA Clone; EEF1E1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggccgcagagttgtcgctactggagaagtccctgggactgagtaaggggaataaatacagtgctcagggcgagcgacagattccagttcttcagacaaacaatggtccaagtctaacaggattgactactatagcagctcatctagtcaagcaagccaacaaagaatatttgctggggagtactgcagaagaaaaagcaatcgttcagcagtggttagaatacagggtcactcaagtagatgggcactccagtaaaaatgacatccacacactgttgaaggatcttaattcatatcttgaagataaagtctaccttacagggtataactttacattagcagatatactattgtactatggacttcatcgctttatagttgacctgacagttcaagaaaaggagaaatatcttaatgtgtctcgctggttttgtcacattcagcattatccaggcatcaggcaacatctgtctagtgttgtcttcatcaagaacagactatatactaattcccactag
Sequence Length
525
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,548 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation elongation factor 1 epsilon 1, mRNA
NCBI Official Synonym Full Names
eukaryotic translation elongation factor 1 epsilon 1
NCBI Official Symbol
EEF1E1
NCBI Official Synonym Symbols
P18; AIMP3
NCBI Protein Information
eukaryotic translation elongation factor 1 epsilon-1
UniProt Protein Name
Eukaryotic translation elongation factor 1 epsilon-1
UniProt Gene Name
EEF1E1
UniProt Synonym Gene Names
AIMP3; P18
UniProt Entry Name
MCA3_HUMAN

NCBI Description

This gene encodes a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, the encoded protein is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. However, its mouse homolog has been shown to translocate to the nucleus in response to DNA damage, and it plays a positive role in ATM/ATR-mediated p53 activation. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream MUTED (muted homolog) gene. An EEF1E1-related pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2010]

Uniprot Description

EEF1E1: Positive modulator of ATM response to DNA damage.

Protein type: Translation elongation; Translation

Chromosomal Location of Human Ortholog: 6p24.3

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: glutathione transferase activity; protein binding; translation elongation factor activity

Biological Process: glutathione metabolic process; negative regulation of cell proliferation; positive regulation of apoptosis; positive regulation of DNA damage response, signal transduction by p53 class mediator; tRNA aminoacylation for protein translation

Research Articles on EEF1E1

Similar Products

Product Notes

The EEF1E1 eef1e1 (Catalog #AAA1272146) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg ccgcagagtt gtcgctactg gagaagtccc tgggactgag taaggggaat aaatacagtg ctcagggcga gcgacagatt ccagttcttc agacaaacaa tggtccaagt ctaacaggat tgactactat agcagctcat ctagtcaagc aagccaacaa agaatatttg ctggggagta ctgcagaaga aaaagcaatc gttcagcagt ggttagaata cagggtcact caagtagatg ggcactccag taaaaatgac atccacacac tgttgaagga tcttaattca tatcttgaag ataaagtcta ccttacaggg tataacttta cattagcaga tatactattg tactatggac ttcatcgctt tatagttgac ctgacagttc aagaaaagga gaaatatctt aatgtgtctc gctggttttg tcacattcag cattatccag gcatcaggca acatctgtct agtgttgtct tcatcaagaa cagactatat actaattccc actag. It is sometimes possible for the material contained within the vial of "EEF1E1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.