Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DR1 cdna clone

DR1 cDNA Clone

Gene Names
DR1; NC2; NC2B; NC2-BETA
Synonyms
DR1; DR1 cDNA Clone; DR1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcctcgtctggcaacgatgatgatctcactatccccagagctgctatcaataaaatgatcaaagagactcttcctaatgtccgggtggccaacgatgctcgagagctggtggtgaactgctgcactgaattcattcaccttatatcttctgaagccaatgagatttgtaacaaatcggaaaagaagaccatctcaccagagcatgtcatacaagcactagaaagtttgggatttggctcttacatcagtgaagtaaaagaagtcttgcaagagtgtaaaacagtagcattaaaaagaagaaaggccagttctcgtttggaaaaccttggcattcctgaagaagagttattgagacagcaacaagaattatttgcaaaagctagacagcaacaagcagaattggcccaacaggaatggcttcaaatgcagcaagctgcccaacaagcccagcttgctgctgcctcagccagtgcatctaatcaggcgggatcttctcaggatgaagaagatgatgatgatatctga
Sequence Length
531
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,444 Da
NCBI Official Full Name
Homo sapiens down-regulator of transcription 1, TBP-binding (negative cofactor 2), mRNA
NCBI Official Synonym Full Names
down-regulator of transcription 1
NCBI Official Symbol
DR1
NCBI Official Synonym Symbols
NC2; NC2B; NC2-BETA
NCBI Protein Information
protein Dr1
UniProt Protein Name
Protein Dr1
UniProt Gene Name
DR1
UniProt Synonym Gene Names
NC2-beta
UniProt Entry Name
NC2B_HUMAN

NCBI Description

This gene encodes a TBP- (TATA box-binding protein) associated phosphoprotein that represses both basal and activated levels of transcription. The encoded protein is phosphorylated in vivo and this phosphorylation affects its interaction with TBP. This protein contains a histone fold motif at the amino terminus, a TBP-binding domain, and a glutamine- and alanine-rich region. The binding of DR1 repressor complexes to TBP-promoter complexes may establish a mechanism in which an altered DNA conformation, together with the formation of higher order complexes, inhibits the assembly of the preinitiation complex and controls the rate of RNA polymerase II transcription. [provided by RefSeq, Jul 2008]

Uniprot Description

DR1: The association of the DR1/DRAP1 heterodimer with TBP results in a functional repression of both activated and basal transcription of class II genes. This interaction precludes the formation of a transcription-competent complex by inhibiting the association of TFIIA and/or TFIIB with TBP. Can bind to DNA on its own. Component of the ATAC complex, a complex with histone acetyltransferase activity on histones H3 and H4. Heterodimer with DRAP1. DR1 exists in solution as a homotetramer that dissociates during interaction with TBP and then, after complexing with TBP, reassociates at a slow rate, to reconstitute the tetramer. Interacts with NFIL3. Component of the ADA2A-containing complex (ATAC), composed of CSRP2BP, KAT2A, TADA2L, TADA3L, ZZ3, MBIP, WDR5, YEATS2, CCDC101 and DR1. Belongs to the NC2 beta/DR1 family.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 1p22.1

Cellular Component: nucleus

Molecular Function: protein binding; TATA-binding protein binding; transcription corepressor activity; transcription factor binding

Biological Process: negative regulation of transcription from RNA polymerase II promoter

Research Articles on DR1

Similar Products

Product Notes

The DR1 dr1 (Catalog #AAA1270206) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcct cgtctggcaa cgatgatgat ctcactatcc ccagagctgc tatcaataaa atgatcaaag agactcttcc taatgtccgg gtggccaacg atgctcgaga gctggtggtg aactgctgca ctgaattcat tcaccttata tcttctgaag ccaatgagat ttgtaacaaa tcggaaaaga agaccatctc accagagcat gtcatacaag cactagaaag tttgggattt ggctcttaca tcagtgaagt aaaagaagtc ttgcaagagt gtaaaacagt agcattaaaa agaagaaagg ccagttctcg tttggaaaac cttggcattc ctgaagaaga gttattgaga cagcaacaag aattatttgc aaaagctaga cagcaacaag cagaattggc ccaacaggaa tggcttcaaa tgcagcaagc tgcccaacaa gcccagcttg ctgctgcctc agccagtgca tctaatcagg cgggatcttc tcaggatgaa gaagatgatg atgatatctg a. It is sometimes possible for the material contained within the vial of "DR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.