Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNALI1 cdna clone

DNALI1 cDNA Clone

Gene Names
DNALI1; P28; hp28; dJ423B22.5
Synonyms
DNALI1; DNALI1 cDNA Clone; DNALI1 cdna clone
Ordering
For Research Use Only!
Sequence
atgattccgcccgcagactctttgctcaagtacgacaccccagtgctggtgagccggaacacggagaaacggagccccaaggctcggctactgaaagtcagcccccagcagcctggaccttcaggttcagccccacagccacccaagaccaagctcccctcaactccctgtgtcccagatcctacaaagcaggcagaagaaatcttgaatgccatactacccccaagggagtgggtggaagacacgcagctatggatccagcaggtgtccagcacccctagcaccaggatggacgtggtgcacctccaggagcagttagacttaaagctgcagcagcggcaggccagggaaacaggcatctgccctgtccgcagggaactctactcacagtgttttgatgagttgatccgggaggtcaccatcaactgtgcggagagggggctgctgctgctgcgagtccgggacgagatccgcatgaccatcgctgcctaccagaccctgtacgagagcagcgtggcgtttggcatgaggaaggcactgcaggctgagcaggggaagtcagacatggagaggaaaatcgcagaattggagacggaaaagagagacctggagaggcaagtgaacgagcagaaggcaaaatgtgaagccactgagaagcgggagagcgagaggcggcaggtggaggagaagaagcacaatgaggagattcagttcctgaagcgaacaaatcagcagctgaaggcccaactggaaggcattattgcaccaaagaagtga
Sequence Length
777
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,583 Da
NCBI Official Full Name
Homo sapiens dynein, axonemal, light intermediate chain 1, mRNA
NCBI Official Synonym Full Names
dynein axonemal light intermediate chain 1
NCBI Official Symbol
DNALI1
NCBI Official Synonym Symbols
P28; hp28; dJ423B22.5
NCBI Protein Information
axonemal dynein light intermediate polypeptide 1
UniProt Protein Name
Axonemal dynein light intermediate polypeptide 1
UniProt Gene Name
DNALI1
UniProt Entry Name
IDLC_HUMAN

NCBI Description

This gene is the human homolog of the Chlamydomonas inner dynein arm gene, p28. The precise function of this gene is not known, however, it is a potential candidate for immotile cilia syndrome (ICS). Ultrastructural defects of the inner dynein arms are seen in patients with ICS. Immotile mutant strains of Chlamydomonas, a biflagellated algae, exhibit similar defects. [provided by RefSeq, Jul 2008]

Uniprot Description

DNALI1: May play a dynamic role in flagellar motility. Belongs to the inner dynein arm light chain family.

Protein type: Motor; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 1p35.1

Cellular Component: axonemal dynein complex; axoneme; cytoplasm

Molecular Function: microtubule motor activity; protein binding

Biological Process: cell motility; single fertilization

Research Articles on DNALI1

Similar Products

Product Notes

The DNALI1 dnali1 (Catalog #AAA1278311) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattccgc ccgcagactc tttgctcaag tacgacaccc cagtgctggt gagccggaac acggagaaac ggagccccaa ggctcggcta ctgaaagtca gcccccagca gcctggacct tcaggttcag ccccacagcc acccaagacc aagctcccct caactccctg tgtcccagat cctacaaagc aggcagaaga aatcttgaat gccatactac ccccaaggga gtgggtggaa gacacgcagc tatggatcca gcaggtgtcc agcaccccta gcaccaggat ggacgtggtg cacctccagg agcagttaga cttaaagctg cagcagcggc aggccaggga aacaggcatc tgccctgtcc gcagggaact ctactcacag tgttttgatg agttgatccg ggaggtcacc atcaactgtg cggagagggg gctgctgctg ctgcgagtcc gggacgagat ccgcatgacc atcgctgcct accagaccct gtacgagagc agcgtggcgt ttggcatgag gaaggcactg caggctgagc aggggaagtc agacatggag aggaaaatcg cagaattgga gacggaaaag agagacctgg agaggcaagt gaacgagcag aaggcaaaat gtgaagccac tgagaagcgg gagagcgaga ggcggcaggt ggaggagaag aagcacaatg aggagattca gttcctgaag cgaacaaatc agcagctgaa ggcccaactg gaaggcatta ttgcaccaaa gaagtga. It is sometimes possible for the material contained within the vial of "DNALI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.