Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DEDD2 cdna clone

DEDD2 cDNA Clone

Gene Names
DEDD2; FLAME3; FLAME-3
Synonyms
DEDD2; DEDD2 cDNA Clone; DEDD2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctatccgggtcgaccccggccccgtgctgggaggaggatgagtgcctggactactacgggatgctgtcgcttcaccgtatgttcgaggtggtgggcgggcaactgaccgagtgcgagctggagctcctggcctttctgctggatgaggctcctggcgccgccggaggcttagcccgggcccgcagcggcctagagctcctgctggagctggagcgccgcgggcagtgcgacgagagcaacctgcggctgctggggcaactcctgcgcgtgctggcccgccacgacctgctgccgcacctggcgcgcaagcggcgccggccagtgtctccagaacgctatagctatggcacctccagctcttcaaagaggacagagggtagctgccgtcgccgtcggcagtcaagcagttctgcaaattctcagcagggctcccccccaaccaagcggcagcggcggagtcggggccggcccagtggtggtgccagacggcggcggagaggggccccagccgcaccccagcagcagtcagagcccgcgcagaccttcctctga
Sequence Length
558
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,577 Da
NCBI Official Full Name
Homo sapiens death effector domain containing 2, mRNA
NCBI Official Synonym Full Names
death effector domain containing 2
NCBI Official Symbol
DEDD2
NCBI Official Synonym Symbols
FLAME3; FLAME-3
NCBI Protein Information
DNA-binding death effector domain-containing protein 2
UniProt Protein Name
DNA-binding death effector domain-containing protein 2
UniProt Gene Name
DEDD2
UniProt Synonym Gene Names
FLAME3
UniProt Entry Name
DEDD2_HUMAN

NCBI Description

This gene encodes a nuclear-localized protein containing a death effector domain (DED). The encoded protein may regulate the trafficking of caspases and other proteins into the nucleus during death receptor-induced apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Uniprot Description

DEDD2: May play a critical role in death receptor-induced apoptosis and may target CASP8 and CASP10 to the nucleus. May regulate degradation of intermediate filaments during apoptosis. May play a role in the general transcription machinery in the nucleus and might be an important regulator of the activity of GTF3C3. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: nucleolus; nucleoplasm

Molecular Function: DNA binding; protein binding

Biological Process: apoptotic nuclear changes; induction of apoptosis via death domain receptors

Research Articles on DEDD2

Similar Products

Product Notes

The DEDD2 dedd2 (Catalog #AAA1274179) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctat ccgggtcgac cccggccccg tgctgggagg aggatgagtg cctggactac tacgggatgc tgtcgcttca ccgtatgttc gaggtggtgg gcgggcaact gaccgagtgc gagctggagc tcctggcctt tctgctggat gaggctcctg gcgccgccgg aggcttagcc cgggcccgca gcggcctaga gctcctgctg gagctggagc gccgcgggca gtgcgacgag agcaacctgc ggctgctggg gcaactcctg cgcgtgctgg cccgccacga cctgctgccg cacctggcgc gcaagcggcg ccggccagtg tctccagaac gctatagcta tggcacctcc agctcttcaa agaggacaga gggtagctgc cgtcgccgtc ggcagtcaag cagttctgca aattctcagc agggctcccc cccaaccaag cggcagcggc ggagtcgggg ccggcccagt ggtggtgcca gacggcggcg gagaggggcc ccagccgcac cccagcagca gtcagagccc gcgcagacct tcctctga. It is sometimes possible for the material contained within the vial of "DEDD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.