CNOT8 cdna clone
CNOT8 cDNA Clone
Gene Names
CNOT8; CAF1; POP2; CALIF; Caf1b; hCAF1
Synonyms
CNOT8; CNOT8 cDNA Clone; CNOT8 cdna clone
Sequence
atgcctgcagcacttgtggagaatagccaggttatctgtgaagtgtgggccagtaatctagaagaagagatgaggaagatccgagaaatcgtgctcagttacagttatattgccatggacacagaatttccaggtgttgtggtgcgaccaattggtgaatttcgtagttccatagattaccaatatcagcttctgcggtgcaatgttgaccttttaaaaattatccagctgggccttacattcacaaatgagaagggagagtatccttctggaatcaatacttggcagttcaatttcaaatttaaccttacagaggacatgtactcccaggattccatagatctccttgctaactcaggactacagtttcagaagcatgaagaggaagggattgacacactgcactttgcagagctgcttatgacatcaggagtggttctctgtgacaatgtcaaatggctttcatttcatagtggctatgattttggctatatggtaaagttgcttacagattctcgtttgccagaagaggaacatgaattctttcatattctgaaccttttcttcccatccatttatgatgtgaaatacctgatgaagagctgcaaaaatcttaagggaggtcttcaggaagttgctgatcagttggatttgcagaggattggaaggcagcaccaggcaggctcagactcactgctgacaggaatggctttctttaggatgaaagagttgttttttgaggacagcattgatgatgccaagtactgtgggcggctctatggcttaggcacaggagtggcccagaagcagaatgaggatgtggactctgcccaggagaagatgagcatcctggcgattatcaacaacatgcagcagtga
Sequence Length
879
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,415 Da
NCBI Official Full Name
Homo sapiens CCR4-NOT transcription complex, subunit 8, mRNA
NCBI Official Synonym Full Names
CCR4-NOT transcription complex subunit 8
NCBI Official Symbol
CNOT8
NCBI Official Synonym Symbols
CAF1; POP2; CALIF; Caf1b; hCAF1
NCBI Protein Information
CCR4-NOT transcription complex subunit 8
UniProt Protein Name
CCR4-NOT transcription complex subunit 8
Protein Family
UniProt Gene Name
CNOT8
UniProt Synonym Gene Names
CALIF; POP2; CALIFp
UniProt Entry Name
CNOT8_HUMAN
Uniprot Description
CNOT8: Ubiquitous transcription factor required for a diverse set of processes. The CCR4-NOT complex functions as general transcription regulation complex. Belongs to the CAF1 family.
Protein type: EC 3.1.13.4
Chromosomal Location of Human Ortholog: 5q31-q33
Cellular Component: CCR4-NOT complex; cytosol; intracellular
Molecular Function: 3'-5'-exoribonuclease activity; poly(A)-specific ribonuclease activity; protein binding
Biological Process: DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; miRNA-mediated gene silencing; negative regulation of cell proliferation; poly(A) tail shortening; positive regulation of cell proliferation
Research Articles on CNOT8
Similar Products
Product Notes
The CNOT8 cnot8 (Catalog #AAA1277968) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgcag cacttgtgga gaatagccag gttatctgtg aagtgtgggc cagtaatcta gaagaagaga tgaggaagat ccgagaaatc gtgctcagtt acagttatat tgccatggac acagaatttc caggtgttgt ggtgcgacca attggtgaat ttcgtagttc catagattac caatatcagc ttctgcggtg caatgttgac cttttaaaaa ttatccagct gggccttaca ttcacaaatg agaagggaga gtatccttct ggaatcaata cttggcagtt caatttcaaa tttaacctta cagaggacat gtactcccag gattccatag atctccttgc taactcagga ctacagtttc agaagcatga agaggaaggg attgacacac tgcactttgc agagctgctt atgacatcag gagtggttct ctgtgacaat gtcaaatggc tttcatttca tagtggctat gattttggct atatggtaaa gttgcttaca gattctcgtt tgccagaaga ggaacatgaa ttctttcata ttctgaacct tttcttccca tccatttatg atgtgaaata cctgatgaag agctgcaaaa atcttaaggg aggtcttcag gaagttgctg atcagttgga tttgcagagg attggaaggc agcaccaggc aggctcagac tcactgctga caggaatggc tttctttagg atgaaagagt tgttttttga ggacagcatt gatgatgcca agtactgtgg gcggctctat ggcttaggca caggagtggc ccagaagcag aatgaggatg tggactctgc ccaggagaag atgagcatcc tggcgattat caacaacatg cagcagtga. It is sometimes possible for the material contained within the vial of "CNOT8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
