Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHMP4B cdna clone

CHMP4B cDNA Clone

Gene Names
CHMP4B; SNF7; CTPP3; Shax1; CHMP4A; SNF7-2; VPS32B; CTRCT31; Vps32-2; C20orf178; dJ553F4.4
Synonyms
CHMP4B; CHMP4B cDNA Clone; CHMP4B cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggtgttcgggaagctgttcggggctggagggggtaaggccggcaagggcggcccgaccccccaggaggccatccagcggctgcgggacacggaagagatgttaagcaagaaacaggagttcctggagaagaaaatcgagcaggagctgacggccgccaagaagcacggcaccaaaaacaagcgcgcggccctccaggcactgaagcgtaagaagaggtatgagaagcagctggcgcagatcgacggcacattatcaaccatcgagttccagcgggaggccctggagaatgccaacaccaacaccgaggtgctcaagaacatgggctatgccgccaaggccatgaaggcggcccatgacaacatggacatcgataaagttgatgagttaatgcaggacattgctgaccagcaagaacttgcagaggagatttcaacagcaatttcgaaacctgtagggtttggagaagagtttgacgaggatgagctcatggcggaattagaagaactagaacaggaggaactagacaagaatttgctggaaatcagtggacccgaaacagtccctctaccaaatgttccctctatagccctaccatcaaaacccgccaagaagaaagaagaggaggacgacgacatgaaggaattggagaactgggctggatccatgtaa
Sequence Length
675
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,950 Da
NCBI Official Full Name
Homo sapiens chromatin modifying protein 4B, mRNA
NCBI Official Synonym Full Names
charged multivesicular body protein 4B
NCBI Official Symbol
CHMP4B
NCBI Official Synonym Symbols
SNF7; CTPP3; Shax1; CHMP4A; SNF7-2; VPS32B; CTRCT31; Vps32-2; C20orf178; dJ553F4.4
NCBI Protein Information
charged multivesicular body protein 4b
UniProt Protein Name
Charged multivesicular body protein 4b
UniProt Gene Name
CHMP4B
UniProt Synonym Gene Names
C20orf178; SHAX1; CHMP4b; hSnf7-2; Vps32-2; hVps32-2
UniProt Entry Name
CHM4B_HUMAN

NCBI Description

This gene encodes a member of the chromatin-modifying protein/charged multivesicular body protein (CHMP) protein family. The protein is part of the endosomal sorting complex required for transport (ESCRT) complex III (ESCRT-III), which functions in the sorting of endocytosed cell-surface receptors into multivesicular endosomes. The ESCRT machinery also functions in the final abscisson stage of cytokinesis and in the budding of enveloped viruses such as HIV-1. The three proteins of the CHMP4 subfamily interact with programmed cell death 6 interacting protein (PDCD6IP, also known as ALIX), which also functions in the ESCRT pathway. The CHMP4 proteins assemble into membrane-attached 5-nm filaments that form circular scaffolds and promote or stabilize outward budding. These polymers are proposed to help generate the luminal vesicles of multivesicular bodies. Mutations in this gene result in autosomal dominant posterior polar cataracts.[provided by RefSeq, Oct 2009]

Uniprot Description

CHMP4B: Probable core component of the endosomal sorting required for transport complex III (ESCRT-III) which is involved in multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. The MVB pathway appears to require the sequential function of ESCRT-O, -I,-II and -III complexes. ESCRT-III proteins mostly dissociate from the invaginating membrane before the ILV is released. The ESCRT machinery also functions in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis and the budding of enveloped viruses (HIV-1 and other lentiviruses). ESCRT-III proteins are believed to mediate the necessary vesicle extrusion and/or membrane fission activities, possibly in conjunction with the AAA ATPase VPS4. When overexpressed, membrane-assembled circular arrays of CHMP4B filaments can promote or stabilize negative curvature and outward budding. Via its interaction with PDCD6IP involved in HIV-1 p6- and p9-dependent virus release. Defects in CHMP4B are the cause of cataract posterior polar type 3 (CTPP3). A subcapsular opacity, usually disk-shaped, located at the back of the lens. It can have a marked effect on visual acuity. Belongs to the SNF7 family.

Protein type: Membrane protein, peripheral

Chromosomal Location of Human Ortholog: 20q11.22

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; endosome; internal side of plasma membrane; membrane coat; midbody; nuclear envelope; nucleus; vesicle

Molecular Function: identical protein binding; protein binding; protein homodimerization activity

Biological Process: autophagy; cell separation during cytokinesis; cytokinesis after mitosis; endosome transport; exit from mitosis; mitotic metaphase plate congression; non-lytic virus budding; nuclear envelope reassembly; nuclear organization and biogenesis; posttranslational protein targeting to membrane; protein homooligomerization; regulation of viral reproduction; viral infectious cycle

Disease: Cataract 31, Multiple Types

Research Articles on CHMP4B

Similar Products

Product Notes

The CHMP4B chmp4b (Catalog #AAA1271986) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggtgt tcgggaagct gttcggggct ggagggggta aggccggcaa gggcggcccg accccccagg aggccatcca gcggctgcgg gacacggaag agatgttaag caagaaacag gagttcctgg agaagaaaat cgagcaggag ctgacggccg ccaagaagca cggcaccaaa aacaagcgcg cggccctcca ggcactgaag cgtaagaaga ggtatgagaa gcagctggcg cagatcgacg gcacattatc aaccatcgag ttccagcggg aggccctgga gaatgccaac accaacaccg aggtgctcaa gaacatgggc tatgccgcca aggccatgaa ggcggcccat gacaacatgg acatcgataa agttgatgag ttaatgcagg acattgctga ccagcaagaa cttgcagagg agatttcaac agcaatttcg aaacctgtag ggtttggaga agagtttgac gaggatgagc tcatggcgga attagaagaa ctagaacagg aggaactaga caagaatttg ctggaaatca gtggacccga aacagtccct ctaccaaatg ttccctctat agccctacca tcaaaacccg ccaagaagaa agaagaggag gacgacgaca tgaaggaatt ggagaactgg gctggatcca tgtaa. It is sometimes possible for the material contained within the vial of "CHMP4B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.