Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCDC59 cdna clone

CCDC59 cDNA Clone

Gene Names
CCDC59; BR22; TAP26; HSPC128
Synonyms
CCDC59; CCDC59 cDNA Clone; CCDC59 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgccggtgaggcggtccgcgaagtggcggcctggtggtattgaggcgcgtggtgaaggggtttccactgtcgggtacaggaataagaatgtgagacagaagacatggcggcctaaccacccgcaagccttcgtggggagcgttcgcgagggacaaggctttgcttttcgaagaaaactgaaaatacagcaaagttacaagaaattgctacggaaggaaaagaaggctcaaacgtcactggaatctcaattcacagatcgatacccagataatctgaaacatctctatttagctgaagaggaaagacataggaagcaagcaagaaaagtcgaccatcctttgtcagaacaagttcaccagccgttgcttgaagaacagtgtagcattgacgagcctttatttgaagatcagtgtagctttgaccagcctcagccagaagaacaatgtattaaaacagtaaactcctttacaattccaaagaaaaataaaaagaaaacatcaaatcaaaaagcacaagaagaatatgaacagatacaagccaaacgtgctgctaagaaacaagaattcgagaggagaaaacaggagagagaagaagcccaaaggcagtacaaaaagaagaaaatggaagtgtttaaaatactgaacaaaaagactaaaaagggccaaccaaacttgaatgtacaaatggagtaccttcttcaaaaaatacaagaaaaatgttaa
Sequence Length
726
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,670 Da
NCBI Official Full Name
Homo sapiens coiled-coil domain containing 59, mRNA
NCBI Official Synonym Full Names
coiled-coil domain containing 59
NCBI Official Symbol
CCDC59
NCBI Official Synonym Symbols
BR22; TAP26; HSPC128
NCBI Protein Information
thyroid transcription factor 1-associated protein 26
UniProt Protein Name
Thyroid transcription factor 1-associated protein 26
UniProt Gene Name
CCDC59
UniProt Synonym Gene Names
BR22; TAP26; TTF-1-associated protein 26
UniProt Entry Name
TAP26_HUMAN

Uniprot Description

CCDC59: Component of the transcription complexes of the pulmonary surfactant-associated protein-B (SFTPB) and -C (SFTPC). Enhances homeobox protein Nkx-2.1-activated SFTPB and SFTPC promoter activities. Belongs to the TAP26 family.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 12q21.31

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: cellular protein metabolic process; maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)

Similar Products

Product Notes

The CCDC59 ccdc59 (Catalog #AAA1276518) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccgg tgaggcggtc cgcgaagtgg cggcctggtg gtattgaggc gcgtggtgaa ggggtttcca ctgtcgggta caggaataag aatgtgagac agaagacatg gcggcctaac cacccgcaag ccttcgtggg gagcgttcgc gagggacaag gctttgcttt tcgaagaaaa ctgaaaatac agcaaagtta caagaaattg ctacggaagg aaaagaaggc tcaaacgtca ctggaatctc aattcacaga tcgataccca gataatctga aacatctcta tttagctgaa gaggaaagac ataggaagca agcaagaaaa gtcgaccatc ctttgtcaga acaagttcac cagccgttgc ttgaagaaca gtgtagcatt gacgagcctt tatttgaaga tcagtgtagc tttgaccagc ctcagccaga agaacaatgt attaaaacag taaactcctt tacaattcca aagaaaaata aaaagaaaac atcaaatcaa aaagcacaag aagaatatga acagatacaa gccaaacgtg ctgctaagaa acaagaattc gagaggagaa aacaggagag agaagaagcc caaaggcagt acaaaaagaa gaaaatggaa gtgtttaaaa tactgaacaa aaagactaaa aagggccaac caaacttgaa tgtacaaatg gagtaccttc ttcaaaaaat acaagaaaaa tgttaa. It is sometimes possible for the material contained within the vial of "CCDC59, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.